TkA04G127880 | RubberDandelionOmics

Gene overview

TkA04G127880

Reference: TK1151 Chr: Chr04 Coordinates: 33256103-33259643 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2008 bp · TkA04G127880|TK1151|cDNA

TATTAACCAAAAAAGTTGGATACTTTTTTTCACAAGACTCGATATTCTTTGGGCAAAATTCCTATGGGCTAATAATTAACGGCGAGAACAAAAATCTAAACAGTAATTATCGAACTACCCGTTTTCAACCGTTAACACATCTCTGCTCTCTCCTTCTCCGGTTCTCCCCCGTGCATCGGCGGTCAAAGACTAATGGCGACAAGTTCCGGCGGTGGCGAAACGCCATTGAAGCCGCAAGCTCAACCACCCAAACTCACATC...

CDS

Download CDS FASTA

1548 bp · TkA04G127880|TK1151|CDS

ATGGCGACAAGTTCCGGCGGTGGCGAAACGCCATTGAAGCCGCAAGCTCAACCACCCAAACTCACATCCGAATCTACCCCCACAACGGAAATTAAAAAGCTCCAACCTCTCGATTCATCCCCAAATCCCATTACTCCTCCCAACCCCACCTCCGCCCCTCCCATCCCCACCACCGATTCCAAGCAAACAACCCCTCCCTCCACCGTCAATTCACGGCCTCGTGAACCCTCTTCCGTACCTGACGCCGATGTCATCCACGT...

Protein

Download Protein FASTA

515 aa · TkA04G127880|TK1151|PROTEIN

MATSSGGGETPLKPQAQPPKLTSESTPTTEIKKLQPLDSSPNPITPPNPTSAPPIPTTDSKQTTPPSTVNSRPREPSSVPDADVIHVPSYSRWFSWNYIHECEARMLPEFFDGKSPSKTPKVYKYYRNAIIKKFRDSIKETPPSKENPMPKITFTEARRIIIGDVGSVRKVFDFLETWGLINYFGSPITKAQLKWEDKESKNVSASSQQNTDPGITNSVTDSGAQKKKFCSSCNSLCTIACFTNIKKDTTFCARCYVRAG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G127880`
TK1151 ID	TkA04G127880
OH-1004 ID	LXL04_035476
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G127880

Location Chr04:33256103-33259643 (-)

Description Similar to SWI3B: SWI/SNF complex subunit SWI3B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g33610`	Component of a multiprotein complex equivalent of the SWI/SNF complex, an ATP-dependent chromatin-remodeling complex, which is required for the positive and negative regulation of gene expression of a large number of genes.	AtSWI3B, an Arabidopsis homolog of SWI3, a core subunit of yeast Swi/Snf chromatin remodeling complex, interacts with FCA, a regulator of flowering time.2002 · DOI: 10.1093/nar/gkf458 CHB2, a member of the SWI3 gene family, is a global regulator in Arabidopsis.2003 · DOI: 10.1023/b:plan.0000004305.60407.8b SWI3 subunits of putative SWI/SNF chromatin-remodeling complexes play distinct roles during Arabidopsis development.2005 · DOI: 10.1105/tpc.105.031203
`At2g47620`	Component of a multiprotein complex equivalent of the SWI/SNF complex, an ATP-dependent chromatin-remodeling complex, which is required for the positive and negative regulation of gene expression of a large number of genes.	SWI3 subunits of putative SWI/SNF chromatin-remodeling complexes play distinct roles during Arabidopsis development.2005 · DOI: 10.1105/tpc.105.031203

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035476 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006325 chromatin organization Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0045815 transcription initiation-coupled chromatin remodeling Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:2000070 regulation of response to water deprivation Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G21700

ath:AT2G33610

dosa:Os04g0480300

dosa:Os11g0183700

spo:2541851

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.954

Rank 1 · TkA04G127880 · TK1151

Cytoplasm0.104

Rank 2 · TkA04G127880 · TK1151

Cell membrane0.025

Rank 3 · TkA04G127880 · TK1151

Mitochondrion0.012

Rank 4 · TkA04G127880 · TK1151

Endoplasmic reticulum0.011

Rank 5 · TkA04G127880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04433SWIRM95-183 aa

PF09726Macoilin199-229 aa

PF00249Myb_DNA-binding276-320 aa

PF13921Myb_DNA-bind_6279-320 aa

PF16495SWIRM-assoc_1380-390 aa

PF09726Macoilin385-513 aa

PF16495SWIRM-assoc_1431-492 aa

PF04433SWIRM435-461 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G127880	`PF04433`	SWIRM	95	183	2.5e-22	79.6
TkA04G127880	`PF09726`	Macoilin	199	229	3.3	6.9
TkA04G127880	`PF00249`	Myb_DNA-binding	276	320	2.2e-12	47.6
TkA04G127880	`PF13921`	Myb_DNA-bind_6	279	320	4.5e-09	37.1
TkA04G127880	`PF16495`	SWIRM-assoc_1	380	390	3.4e-06	27.6
TkA04G127880	`PF09726`	Macoilin	385	513	3.3	6.9
TkA04G127880	`PF16495`	SWIRM-assoc_1	431	492	3.4e-06	27.6
TkA04G127880	`PF04433`	SWIRM	435	461	2.5e-22	79.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JG2`	Arabidopsis thaliana	sp\|Q84JG2\|SWI3B_ARATH SWI/SNF complex subunit SWI3B	49.200%	Swiss-Prot	Medium
`Q8W475`	Arabidopsis thaliana	sp\|Q8W475\|SWI3A_ARATH SWI/SNF complex subunit SWI3A	29.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card