TkA04G127600 | RubberDandelionOmics

Gene overview

TkA04G127600

Reference: TK1151 Chr: Chr04 Coordinates: 33160983-33163597 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1366 bp · TkA04G127600|TK1151|cDNA

GTTTGAATATTTTCCTTAATCTTTATCGAAAATACGGGGAGTAAAATCCGAAGAAGATCAAAGGGGTCGACTTTCCTTGGCATTTCCGTTATGTGGTGCACTGGTACCTGACAATTGAATCAACCATTAACGCGCACACCGACCCAGCCACCCCACCCCCAGCTTATATACCTCGGCAACAAGATCTTCTCCTCATTTCCCAGAAATGCAGCAGTAGTTGCATTTCTTTCCCACCCCGCAAGATCTGAGCTGTAATCATT...

CDS

Download CDS FASTA

870 bp · TkA04G127600|TK1151|CDS

ATGAATCGCCGTGCAAATTATGGTTTTGTCATTCTATTCCTCTTCGTTTTCCTCGTTGCTTCTCGCGTTTCTGCGCAGGATGTTGCCGGTGATAATGATAAGGAAGACTCAACCGGATCCATTATAGATCTAGGTCGGCGTGGCAAAGTTGTTGTGGAAACAATAAAAAAGAATGTCATAGGTGACAAGATTGATCCAAAAGCCATAATGAATTTGGATTCTGGCCTTGGTGTTCTCGATGCATTCTTTGCCAGTTTTTC...

Protein

Download Protein FASTA

289 aa · TkA04G127600|TK1151|PROTEIN

MNRRANYGFVILFLFVFLVASRVSAQDVAGDNDKEDSTGSIIDLGRRGKVVVETIKKNVIGDKIDPKAIMNLDSGLGVLDAFFASFSMILVSEIGDETFIIAALMAMRHPKSIVLSGALSALFVMTILSTGLGRIVPNLISRKHTNSAATVLYLFFGLRLLYIAWRSDSKASQKKEMEEVEEKLESGQGKTAARRFLSRFCTPIFLESFILTFLAEWGDRSQIATIALATHKNAIGVALGATIGHTICTSIAVIGGSMLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G127600`
TK1151 ID	TkA04G127600
OH-1004 ID	LXL04_035483
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	88.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G127600

Location Chr04:33160983-33163597 (+)

Description Similar to At5g36290: GDT1-like protein 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g36290`	GDT1-like protein 3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2ZE50`	GDT1-like protein 3.	No verified direct reference in this release
`Os11g0472500`	GDT1-like protein 3.	No verified direct reference in this release
`UniProt: A2YXC7`	GDT1-like protein 4.	No verified direct reference in this release
`Os08g0528500`	GDT1-like protein 4.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035483 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006816 calcium ion transport Biological Process

GO:0006828 manganese ion transport Biological Process

GO:0032468 Golgi calcium ion homeostasis Biological Process

GO:0032472 Golgi calcium ion transport Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0071421 manganese ion transmembrane transport Biological Process

GO:0005794 Golgi apparatus Cellular Component

GO:0016020 membrane Cellular Component

GO:1990676 Golgi trans cisterna membrane Cellular Component

GO:0005384 manganese ion transmembrane transporter activity Molecular Function

GO:0005388 P-type calcium transporter activity Molecular Function

GO:0015085 calcium ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT5G36290

dosa:Os08g0528500

dosa:Os11g0472500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.313

Rank 1 · TkA04G127600 · TK1151

Endoplasmic reticulum0.298

Rank 2 · TkA04G127600 · TK1151

Lysosome / Vacuole0.197

Rank 3 · TkA04G127600 · TK1151

Cytoplasm0.107

Rank 4 · TkA04G127600 · TK1151

Cell membrane0.078

Rank 5 · TkA04G127600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01169GDT181-166 aa

PF16955OFeT_181-184 aa

PF11145DUF292185-180 aa

PF01595CNNM104-155 aa

PF01169GDT1205-282 aa

PF31172Gly-zipper_C13G5-2222-256 aa

PF01595CNNM237-260 aa

PF16955OFeT_1241-264 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G127600	`PF01169`	GDT1	81	166	8.6e-47	158.0
TkA04G127600	`PF16955`	OFeT_1	81	184	0.0026	18.2
TkA04G127600	`PF11145`	DUF2921	85	180	0.007	16.7
TkA04G127600	`PF01595`	CNNM	104	155	1.6	9.1
TkA04G127600	`PF01169`	GDT1	205	282	8.6e-47	158.0
TkA04G127600	`PF31172`	Gly-zipper_C13G5-2	222	256	0.77	10.6
TkA04G127600	`PF01595`	CNNM	237	260	1.6	9.1
TkA04G127600	`PF16955`	OFeT_1	241	264	0.0026	18.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93Y38`	Arabidopsis thaliana	sp\|Q93Y38\|GDT13_ARATH GDT1-like protein 3	74.100%	Swiss-Prot	High
`A2ZE50`	Oryza sativa subsp. indica	sp\|A2ZE50\|GDT13_ORYSI GDT1-like protein 3	75.400%	Swiss-Prot	High
`Q2R4J1`	Oryza sativa subsp. japonica	sp\|Q2R4J1\|GDT13_ORYSJ GDT1-like protein 3	75.400%	Swiss-Prot	High
`A2YXC7`	Oryza sativa subsp. indica	sp\|A2YXC7\|GDT14_ORYSI GDT1-like protein 4	90.300%	Swiss-Prot	High
`Q6ZIB9`	Oryza sativa subsp. japonica	sp\|Q6ZIB9\|GDT14_ORYSJ GDT1-like protein 4	90.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card