TkA04G127380 | RubberDandelionOmics

Gene overview

TkA04G127380

Reference: TK1151 Chr: Chr04 Coordinates: 33089123-33092473 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1887 bp · TkA04G127380|TK1151|cDNA

TCTCAGCCCATCCATGTGTAATTTAAGTCGTTCATATCTAATACTTATAGAAGTAGAAGTATAGTTAGTCAACAAAGTTTCGTCCACGACATTTCTACACTCCCTCTACCTGCTCTTGCTGTGGTTTGCAACAGTCCTGCTCAACAATGGAGGAAGAGAGAAAGAGATTGGTGGAGGGAGAATGGAACTCCATGATTTCAACCAACCAGCAAATCTCTCGTGCAGATTTCCCTTCCAATTTCCTCTTTGGCGTCGCTACT...

CDS

Download CDS FASTA

1485 bp · TkA04G127380|TK1151|CDS

ATGGAGGAAGAGAGAAAGAGATTGGTGGAGGGAGAATGGAACTCCATGATTTCAACCAACCAGCAAATCTCTCGTGCAGATTTCCCTTCCAATTTCCTCTTTGGCGTCGCTACTGCTGCTTATCAGGTTGAAGGAGCTGCAAATCAGGGTGGCAGGGGTCCTTGTATTTGGGATGATTTTTCACACAAAGAAGGCAAAATAAAAGATGGAAAAACTGGAGATATAGCAGTAGATCAATACCATCGTTACAAGGAAGACGT...

Protein

Download Protein FASTA

494 aa · TkA04G127380|TK1151|PROTEIN

MEEERKRLVEGEWNSMISTNQQISRADFPSNFLFGVATAAYQVEGAANQGGRGPCIWDDFSHKEGKIKDGKTGDIAVDQYHRYKEDVDLIAKMGFSAYRFSISWSRIYPDGLGTQVNKEGIMYYNNLINYLLEKGIEPCVTLYHWDLPLHLDESIGGWLNDSIVNYFAIYAETCFENFGDRVKKWITINEPLQTAINGYFSGIFAPGRSERFSAEPYLAAHHQLLAHAHAVSIYRTKFKAVQGGEIGLVVDCEWAEPLTD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G127380`
TK1151 ID	TkA04G127380
OH-1004 ID	LXL04_035490
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G127380

Location Chr04:33089123-33092473 (+)

Description Similar to BGLU42: Beta-glucosidase 42

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g36890`	May catalyze hydrolysis of diverse β-glucosides and oligosaccharides.	β-Glucosidase BGLU42 is a MYB72-dependent key regulator of rhizobacteria-induced systemic resistance and modulates iron deficiency responses in Arabidopsis roots.2014 · DOI: 10.1111/nph.12980 Substrate specificity of glycoside hydrolase family 1 β-glucosidase AtBGlu42 from Arabidopsis thaliana and its molecular mechanism.2022 · DOI: 10.1093/bbb/zbab200
`At1g26560`	Beta-glucosidase 40.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0897600`	Beta-glucosidase 4.	No verified direct reference in this release
`Os03g0212800`	Hydrolyzes glycosides, oligosaccharides and hydrophobic glycosides.	No verified direct reference in this release
`Os10g0323500`	Beta-glucosidase 34.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035490 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009866 induced systemic resistance, ethylene mediated signaling pathway Biological Process

GO:0019748 secondary metabolic process Biological Process

GO:0030245 cellulose catabolic process Biological Process

GO:0031349 positive regulation of defense response Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048046 apoplast Cellular Component

KEGG gene cross-reference

ath:AT1G26560

ath:AT5G36890

dosa:Os03g0212800

dosa:Os10g0323500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.772

Rank 1 · TkA04G127380 · TK1151

Nucleus0.258

Rank 2 · TkA04G127380 · TK1151

Peroxisome0.088

Rank 3 · TkA04G127380 · TK1151

Mitochondrion0.061

Rank 4 · TkA04G127380 · TK1151

Plastid0.042

Rank 5 · TkA04G127380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00232Glyco_hydro_126-484 aa

PF00150Cellulase78-144 aa

PF24990PAS_13160-189 aa

PF00150Cellulase374-408 aa

PF24990PAS_13402-422 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G127380	`PF00232`	Glyco_hydro_1	26	484	5.6e-170	566.5
TkA04G127380	`PF00150`	Cellulase	78	144	0.0022	18.3
TkA04G127380	`PF24990`	PAS_13	160	189	0.048	14.7
TkA04G127380	`PF00150`	Cellulase	374	408	0.0022	18.3
TkA04G127380	`PF24990`	PAS_13	402	422	0.048	14.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FIW4`	Arabidopsis thaliana	sp\|Q9FIW4\|BGL42_ARATH Beta-glucosidase 42	66.600%	Swiss-Prot	High
`Q9FZE0`	Arabidopsis thaliana	sp\|Q9FZE0\|BGL40_ARATH Beta-glucosidase 40	50.900%	Swiss-Prot	High
`Q5N863`	Oryza sativa subsp. japonica	sp\|Q5N863\|BGL04_ORYSJ Beta-glucosidase 4	63.600%	Swiss-Prot	High
`Q8L7J2`	Oryza sativa subsp. japonica	sp\|Q8L7J2\|BGL06_ORYSJ Beta-glucosidase 6	52.000%	Swiss-Prot	High
`Q339X2`	Oryza sativa subsp. japonica	sp\|Q339X2\|BGL34_ORYSJ Beta-glucosidase 34	51.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card