TkA04G126490 | RubberDandelionOmics

Gene overview

TkA04G126490

Reference: TK1151 Chr: Chr04 Coordinates: 32850505-32852227 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

706 bp · TkA04G126490|TK1151|cDNA

GGAAGTTCAAGAACTTTAAATTCGGGTATAAACGTAAACCCCTAAACAGCCACACCGAGCAAGAAGGTGCTATACACACACACTCAGACACATTCTCTCTCTCTGATCGCTGAGCTAGGTTTTATCCATGGCGGCGAGAAATGCACTTCTCAAGTACCTGCGTGTGAATGTGACACCAGTTCTTCCATCTTCATCCGTTCAAAACCCTAGAGTAATTGGAGGAGGAATAATTCAGCTGTTCCGGCGCCATTTTTCCGAGG...

CDS

Download CDS FASTA

399 bp · TkA04G126490|TK1151|CDS

ATGGCGGCGAGAAATGCACTTCTCAAGTACCTGCGTGTGAATGTGACACCAGTTCTTCCATCTTCATCCGTTCAAAACCCTAGAGTAATTGGAGGAGGAATAATTCAGCTGTTCCGGCGCCATTTTTCCGAGGAAGTCAGAGGATCTTTCCTCGACAAATCTGAGGTTACTGATCGAGTGGTCACTTGCGTTAAAAATTTCCAGAAAGTTGATCCCTCCAAGGTTACACCAACTGCCCACTTCCAAAATGATCTTGGATT...

Protein

Download Protein FASTA

132 aa · TkA04G126490|TK1151|PROTEIN

MAARNALLKYLRVNVTPVLPSSSVQNPRVIGGGIIQLFRRHFSEEVRGSFLDKSEVTDRVVTCVKNFQKVDPSKVTPTAHFQNDLGLDSLDTVEVVMALEEEFGFEIPDNDADKISTITHAVDFIASHPQAK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G126490`
TK1151 ID	TkA04G126490
OH-1004 ID	LXL04_035503
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G126490

Location Chr04:32850505-32852227 (+)

Description Similar to MTACP2: Acyl carrier protein 2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65290`	Carrier of the growing fatty acid chain in fatty acid biosynthesis (By similarity).	No verified direct reference in this release
`At2g44620`	Carrier of the growing fatty acid chain in fatty acid biosynthesis (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035503 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006120 mitochondrial electron transport, NADH to ubiquinone Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0022904 respiratory electron transport chain Biological Process

GO:0044571 [2Fe-2S] cluster assembly Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0045271 respiratory chain complex I Cellular Component

KEGG gene cross-reference

ath:AT1G65290

ath:AT2G44620

bta:327702

ncr:NCU05008

spo:2543562

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.937

Rank 1 · TkA04G126490 · TK1151

Cytoplasm0.057

Rank 2 · TkA04G126490 · TK1151

Nucleus0.047

Rank 3 · TkA04G126490 · TK1151

Plastid0.023

Rank 4 · TkA04G126490 · TK1151

Extracellular0.016

Rank 5 · TkA04G126490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14573PP-binding_237-63 aa

PF23297ACP_SdgA_C53-127 aa

PF14573PP-binding_256-130 aa

PF00550PP-binding58-124 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G126490	`PF14573`	PP-binding_2	37	63	2.8e-06	28.2
TkA04G126490	`PF23297`	ACP_SdgA_C	53	127	0.0086	16.9
TkA04G126490	`PF14573`	PP-binding_2	56	130	2.8e-06	28.2
TkA04G126490	`PF00550`	PP-binding	58	124	1.3e-12	48.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80800`	Arabidopsis thaliana	sp\|O80800\|ACPM2_ARATH Acyl carrier protein 2, mitochondrial	75.800%	Swiss-Prot	High
`P53665`	Arabidopsis thaliana	sp\|P53665\|ACPM1_ARATH Acyl carrier protein 1, mitochondrial	48.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card