TkA04G122490 | RubberDandelionOmics

Gene overview

TkA04G122490

Reference: TK1151 Chr: Chr04 Coordinates: 31811947-31816390 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1601 bp · TkA04G122490|TK1151|cDNA

CGCCTTTGAAACCATCACTCCCACTCACCAGGCTTGACTTTGTTGTCCACAAGATAAACCGAACTTCATATTCTCTCATGGGGACGGTGGCTCCCATCTCCCGGAATCTTGCTCCGCCATACGCTAAGGAGTTGACACCCGCCGGAGCTGCTGTGCCCAGCAAGCTCGATGCTGGAGCTCTCTTCGTTCTCAAATCTGCAGGATCATGGTTGCATTGTGGGTACCATTTGACAACAGCAATCGTAGGGCCAGCACTATTA...

CDS

Download CDS FASTA

1386 bp · TkA04G122490|TK1151|CDS

ATGGGGACGGTGGCTCCCATCTCCCGGAATCTTGCTCCGCCATACGCTAAGGAGTTGACACCCGCCGGAGCTGCTGTGCCCAGCAAGCTCGATGCTGGAGCTCTCTTCGTTCTCAAATCTGCAGGATCATGGTTGCATTGTGGGTACCATTTGACAACAGCAATCGTAGGGCCAGCACTATTAAGCCTACCTTTTGTCATGGCGTTATTGGGATGGGAAGGTGGCATAATGGTGTTGGCGCTTGCTGGAATTATCACATT...

Protein

Download Protein FASTA

461 aa · TkA04G122490|TK1151|PROTEIN

MGTVAPISRNLAPPYAKELTPAGAAVPSKLDAGALFVLKSAGSWLHCGYHLTTAIVGPALLSLPFVMALLGWEGGIMVLALAGIITFYSYNLLSLVLEHHAELGHRQLRFRDMAHDILGPRWGRYYVGPLQLATCYGAVIACTLLGGQSLKIIYLLTREDGNMQLSHFIAIFGSFTLILAQIPSFHSLRHINLVSLILCFAYCACTTAGAIYIGHSKKAPTKSYSVTGVGINRIFGFFNAISIICTTYGNGIIPEIQATI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G122490`
TK1151 ID	TkA04G122490
OH-1004 ID	LXL04_004620
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	64.300
Protein coverage (%)	TK1151 93.926 / OH-1004 93.333 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G122490

Location Chr04:31811947-31816390 (+)

Description Similar to GAT1: GABA transporter 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08230`	High affinity gamma-aminobutyric acid (GABA) transporter probably involved in GABA uptake into cells.	AtGAT1, a high affinity transporter for gamma-aminobutyric acid in Arabidopsis thaliana.2006 · DOI: 10.1074/jbc.m510766200
`At5g41800`	May be involved in the transport of GABA.	No verified direct reference in this release
`At2g36590`	Proline transporter that mediates proline and glycine betaine transport.	The AtProT family. Compatible solute transporters with similar substrate specificity but differential expression patterns.2005 · DOI: 10.1104/pp.104.055079
`At3g55740`	Proline transporter that mediates proline and glycine betaine transport.	Identification and characterization of GABA, proline and quaternary ammonium compound transporters from Arabidopsis thaliana.1999 · DOI: 10.1016/s0014-5793(99)00516-5 The AtProT family. Compatible solute transporters with similar substrate specificity but differential expression patterns.2005 · DOI: 10.1104/pp.104.055079 In planta function of compatible solute transporters of the AtProT family.2011 · DOI: 10.1093/jxb/erq320 Salt stress-induced proline transporters and salt stress-repressed broad specificity amino acid permeases identified by suppression of a yeast amino acid permease-targeting mutant.1996 · DOI: 10.1105/tpc.8.8.1437

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q69LA1`	Proline transporter that mediates proline transport across the plasma membrane.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004620 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0003333 amino acid transmembrane transport Biological Process

GO:0006952 defense response Biological Process

GO:0015812 gamma-aminobutyric acid transport Biological Process

GO:0015824 proline transport Biological Process

GO:0043090 amino acid import Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0016020 membrane Cellular Component

GO:0015171 amino acid transmembrane transporter activity Molecular Function

GO:0015172 acidic amino acid transmembrane transporter activity Molecular Function

GO:0015185 gamma-aminobutyric acid transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G08230

ath:AT2G39890

ath:AT5G40780

ath:AT5G41800

dosa:Os07g0100800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.741

Rank 1 · TkA04G122490 · TK1151

Lysosome / Vacuole0.108

Rank 2 · TkA04G122490 · TK1151

Cytoplasm0.102

Rank 3 · TkA04G122490 · TK1151

Endoplasmic reticulum0.073

Rank 4 · TkA04G122490 · TK1151

Golgi apparatus0.040

Rank 5 · TkA04G122490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01490Aa_trans42-449 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G122490	`PF01490`	Aa_trans	42	449	5.7e-65	220.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HW02`	Arabidopsis thaliana	sp\|F4HW02\|GAT1_ARATH GABA transporter 1	59.200%	Swiss-Prot	High
`Q8L4X4`	Arabidopsis thaliana	sp\|Q8L4X4\|GAT2_ARATH Probable GABA transporter 2	47.100%	Swiss-Prot	Medium
`Q9SJP9`	Arabidopsis thaliana	sp\|Q9SJP9\|PROT3_ARATH Proline transporter 3	32.600%	Swiss-Prot	Medium
`P92962`	Arabidopsis thaliana	sp\|P92962\|PROT2_ARATH Proline transporter 2	33.400%	Swiss-Prot	Medium
`Q69LA1`	Oryza sativa subsp. japonica	sp\|Q69LA1\|PROT2_ORYSJ Probable proline transporter 2	33.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card