TkA04G120180 | RubberDandelionOmics

Gene overview

TkA04G120180

Reference: TK1151 Chr: Chr04 Coordinates: 31226092-31232291 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2244 bp · TkA04G120180|TK1151|cDNA

GGGGTCAAAAACGTGATTTGTATTTTTATATTTAGCGTAAAAAATAACAAGAGATTTTTGGGACCCATATAAATAAAATCTCAATTTCGAAGGTCCAAAAAGAAACATAAAAAGTTACAAACGCCATCCTTCATCCTTCCCCGTCCACGTTGGCTATTTGGCGCGAAGCTGACTTGTCAATAAAACACGTCAGTTGCCAGATAGGCATTGGCGCCAAAAAAACCCTATTAGTTTGCAGTCGTTGTCTATCATTTGTATCT...

CDS

Download CDS FASTA

1731 bp · TkA04G120180|TK1151|CDS

ATGTCTCTTGGGCTTGTATCAAAAACCCTATTAGTTTGCAGTCGTTGTCTATCATTTGTATCTTCACAACAACACACACATACACCATCTGTGCAAATGGATTCCGCCGGAGCTTCTTCGTCGTCGTTTGATTCGTTTAAATCGAAGAAAGTCCTCCGCTCCTCCGTCAGCAAACAACATTCCGACGATAAAGCACTTGGAGCACCACATCAGAGTCCGTCGAGCTCCAATACTCCTGAAAAGCCTACACCTCCGCCACG...

Protein

Download Protein FASTA

576 aa · TkA04G120180|TK1151|PROTEIN

MSLGLVSKTLLVCSRCLSFVSSQQHTHTPSVQMDSAGASSSSFDSFKSKKVLRSSVSKQHSDDKALGAPHQSPSSSNTPEKPTPPPRRPITRRQPLRSVKQIREAAQQLRKSDLKPSVSSDPLAFLDTTTETPITKPKIPKALPERFEMLDNFFKSLQSAIRLLRLKGSASTFTNISRAVEKLTDRRFTHKHLAQLKFIFPEGIETRKILLRDDVTSCIKPDLDVTFNFSVIQNDEMLESGNRNLQMGKLFRSRLVSYYK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G120180`
TK1151 ID	TkA04G120180
OH-1004 ID	LXL04_035619
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 98.438 / OH-1004 60.837 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G120180

Location Chr04:31226092-31232291 (+)

Description Similar to CDT1A: CDT1-like protein a, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g31270`	Member of the pre-replication complex.	Cell and plastid division are coordinated through the prereplication factor AtCDT1.2005 · DOI: 10.1073/pnas.0502564102
`At3g54710`	Member of the pre-replication complex.	Cell and plastid division are coordinated through the prereplication factor AtCDT1.2005 · DOI: 10.1073/pnas.0502564102

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035619 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000076 DNA replication checkpoint signaling Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0006260 DNA replication Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0030174 regulation of DNA-templated DNA replication initiation Biological Process

GO:0048229 gametophyte development Biological Process

GO:0051276 chromosome organization Biological Process

GO:0071163 DNA replication preinitiation complex assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0004693 cyclin-dependent protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G31270

ath:AT3G54710

hsa:79830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.913

Rank 1 · TkA04G120180 · TK1151

Cytoplasm0.196

Rank 2 · TkA04G120180 · TK1151

Mitochondrion0.021

Rank 3 · TkA04G120180 · TK1151

Cell membrane0.018

Rank 4 · TkA04G120180 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA04G120180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08839CDT1143-207 aa

PF16679CDT1_C144-192 aa

PF16679CDT1_C458-546 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G120180	`PF08839`	CDT1	143	207	1.3e-10	42.4
TkA04G120180	`PF16679`	CDT1_C	144	192	2.8e-19	70.2
TkA04G120180	`PF16679`	CDT1_C	458	546	2.8e-19	70.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJW9`	Arabidopsis thaliana	sp\|Q9SJW9\|CDT1A_ARATH CDT1-like protein a, chloroplastic	33.200%	Swiss-Prot	Medium
`Q9M1S9`	Arabidopsis thaliana	sp\|Q9M1S9\|CDT1B_ARATH CDT1-like protein b	34.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card