RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G117030
Reference: TK1151 Chr: Chr04 Coordinates: 30443306-30447456 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2448 bp · TkA04G117030|TK1151|cDNA

AAAAAATTTATAAAAATAAATATAACATATAAATAAAATACTTATTTGACATCGATGGACCCATTTAGACCTACAAATCAATGTGCTTTTGGTACCAAAGATCCAACTCCAACAGCATCCACTATTTCAGACAGCCATGATACCACCTCTACATGCTTCGCACTCATACCCTTTTGGCAATTTCAAACAAAAAATTCAAGAGCAGTTAACTTCATATTCACTCAATAACAATACCCTTTTCACAATTTCTTCAATTCTTC...

CDS

Download CDS FASTA

1908 bp · TkA04G117030|TK1151|CDS

ATGGGTGTTCCGATTCGAGCAGCAGGGGTGGATAATCTGAGCGATAAAGCCACGATGATGAGAGAATCACTACAGAAGAGTCAATCGATCACGGACAATATGGTTTCTATGCTGGGTTCTTTTGACCACCGTCTCTCCGCCCTAGAAACTGCCATGCGTCCTACCCAAATAAGGACACATGCAATACGCCGAGCTCATGAGAACATTGACAAGACTTTAAAGGCTGCTAATGTTATATTGGACAGATTCGACATTTCTCG...

Protein

Download Protein FASTA

635 aa · TkA04G117030|TK1151|PROTEIN

MGVPIRAAGVDNLSDKATMMRESLQKSQSITDNMVSMLGSFDHRLSALETAMRPTQIRTHAIRRAHENIDKTLKAANVILDRFDISREAESKIVRGPHEDLEGYLEAIEHLRSNIRFFNNNKSFKSSDGVLNHANSLLSKAITKLEHEFKQLLSSYSKPVEPDRLYECLPNSLRPSSGSPDINGKNPSSHTDRITTENAVYNPPVLIPPRVLPLLHDLAHHMVHAGNSQQCMIIYRDTRSQVLQESLHQLGVEKLSKDDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G117030
TK1151 IDTkA04G117030
OH-1004 IDLXL04_022164
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)86.300
Protein coverage (%)TK1151 100.000 / OH-1004 99.077
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G117030
LocationChr04:30443306-30447456 (+)
DescriptionSimilar to EXO70A1: Exocyst complex component EXO70A1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g03540 Component of the exocyst complex involved in the docking of exocytic vesicles with fusion sites on the plasma membrane during regulated or polarized secretion.
AtEXO70A1, a member of a family of putative exocyst subunits specifically expanded in land plants, is important for polar growth and plant development.2006 · DOI: 10.1111/j.1365-313x.2006.02854.x
Arabidopsis exocyst subunits SEC8 and EXO70A1 and exocyst interactor ROH1 are involved in the localized deposition of seed coat pectin.2010 · DOI: 10.1111/j.1469-8137.2010.03372.x
The Arabidopsis exocyst complex is involved in cytokinesis and cell plate maturation.2010 · DOI: 10.1105/tpc.110.074351
The exocyst complex contributes to PIN auxin efflux carrier recycling and polar auxin transport in Arabidopsis.2013 · DOI: 10.1111/tpj.12074
EXO70A1-mediated vesicle trafficking is critical for tracheary element development in Arabidopsis.2013 · DOI: 10.1105/tpc.113.112144
Microtubule-dependent targeting of the exocyst complex is necessary for xylem development in Arabidopsis.2017 · DOI: 10.1111/nph.14267
At5g52350 Component of the exocyst complex involved in the docking of exocytic vesicles with fusion sites on the plasma membrane during regulated or polarized secretion. No verified direct reference in this release
At5g58430 Component of an exocyst subcomplex specifically involved in autophagy-related, Golgi-independent membrane traffic to the vacuole.
Arabidopsis exocyst subcomplex containing subunit EXO70B1 is involved in autophagy-related transport to the vacuole.2013 · DOI: 10.1111/tra.12101
The N-Terminal UND Motif of the Arabidopsis U-Box E3 Ligase PUB18 Is Critical for the Negative Regulation of ABA-Mediated Stomatal Movement and Determines Its Ubiquitination Specificity for Exocyst Subunit Exo70B1.2016 · DOI: 10.1105/tpc.16.00347
At5g13990 Required for optimal tip growth of pollen tube.
EXO70C2 Is a Key Regulatory Factor for Optimal Tip Growth of Pollen.2017 · DOI: 10.1104/pp.16.01282
Regulation of Exocyst Function in Pollen Tube Growth by Phosphorylation of Exocyst Subunit EXO70C2.2020 · DOI: 10.3389/fpls.2020.609600
At5g13150 Required for global plant growth and for male transmission.
Expression and functional analyses of EXO70 genes in Arabidopsis implicate their roles in regulating cell type-specific exocytosis.2010 · DOI: 10.1104/pp.110.164178
EXO70C2 Is a Key Regulatory Factor for Optimal Tip Growth of Pollen.2017 · DOI: 10.1104/pp.16.01282

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_022164 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000919 cell plate assembly Biological Process
GO:0006887 exocytosis Biological Process
GO:0006952 defense response Biological Process
GO:0006955 immune response Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009630 gravitropism Biological Process
GO:0009734 auxin-activated signaling pathway Biological Process
GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process
GO:0009832 plant-type cell wall biogenesis Biological Process
GO:0010015 root morphogenesis Biological Process
GO:0010089 xylem development Biological Process
GO:0010102 lateral root morphogenesis Biological Process
KEGG gene cross-reference
ath:AT5G03540
ath:AT5G13150
ath:AT5G13990
ath:AT5G52350
ath:AT5G58430
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.617
Rank 1 · TkA04G117030 · TK1151
Cell membrane0.364
Rank 2 · TkA04G117030 · TK1151
Nucleus0.189
Rank 3 · TkA04G117030 · TK1151
Golgi apparatus0.102
Rank 4 · TkA04G117030 · TK1151
Lysosome / Vacuole0.059
Rank 5 · TkA04G117030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09763Sec3_CC13-111 aa
PF04129Vps52_CC17-145 aa
PF04136COG3_N21-154 aa
PF09177STX6_10_61_N31-52 aa
PF20669Exo70_N72-154 aa
PF03081Exo70_C90-156 aa
PF26086Niban294-157 aa
PF09177STX6_10_61_N107-152 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G117030PF09763Sec3_CC131110.05714.0
TkA04G117030PF04129Vps52_CC171450.2311.8
TkA04G117030PF04136COG3_N211540.02415.3
TkA04G117030PF09177STX6_10_61_N31520.1413.5
TkA04G117030PF20669Exo70_N721548.2e-2071.6
TkA04G117030PF03081Exo70_C901564.8e-131437.9
TkA04G117030PF26086Niban2941570.1612.8
TkA04G117030PF09177STX6_10_61_N1071520.1413.5
TkA04G117030PF09763Sec3_CC1201570.05714.0
TkA04G117030PF26086Niban22372680.1612.8
TkA04G117030PF03800Nuf22453040.06114.1
TkA04G117030PF03081Exo70_C2746284.8e-131437.9
TkA04G117030PF26086Niban23274330.1612.8
TkA04G117030PF09177STX6_10_61_N3484030.1413.5
TkA04G117030PF03800Nuf24094450.06114.1
TkA04G117030PF04136COG3_N4234410.02415.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LZD3Arabidopsis thalianasp|Q9LZD3|E70A1_ARATH Exocyst complex component EXO70A177.700%Swiss-ProtHigh
F4KG58Arabidopsis thalianasp|F4KG58|E70A3_ARATH Exocyst complex component EXO70A357.700%Swiss-ProtHigh
Q9FGH9Arabidopsis thalianasp|Q9FGH9|E70B1_ARATH Exocyst complex component EXO70B132.800%Swiss-ProtMedium
Q9FFX6Arabidopsis thalianasp|Q9FFX6|E70C2_ARATH Exocyst complex component EXO70C232.300%Swiss-ProtMedium
Q9FY95Arabidopsis thalianasp|Q9FY95|E70C1_ARATH Exocyst complex component EXO70C133.000%Swiss-ProtMedium

JBrowse

View in Genome Browser