TkA04G114500 | RubberDandelionOmics

Gene overview

TkA04G114500

Reference: TK1151 Chr: Chr04 Coordinates: 29730106-29730690 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

498 bp · TkA04G114500|TK1151|cDNA

ATGCATGAACGTTCCATCTGCGGTTTTACAGGCGTGGAGTGCTCGGAGAATAAGAACACTGTTATTCGTATTCAGCTTATAGATAGTAGACTAAGCGGACCATTTCCAATTGGCATAAGAAACTGTACCAACTTGAAATTTTTATTTCTTTCTATCAATGACCTCTCAGGACCCATTCCTTTCGATCTCGGTGATAGTCTACAATCCATCGAATATCTACATCTATCCAACAATAGTCTTTCAGATTTGACTAAACTTGA...

CDS

Download CDS FASTA

498 bp · TkA04G114500|TK1151|CDS

ATGCATGAACGTTCCATCTGCGGTTTTACAGGCGTGGAGTGCTCGGAGAATAAGAACACTGTTATTCGTATTCAGCTTATAGATAGTAGACTAAGCGGACCATTTCCAATTGGCATAAGAAACTGTACCAACTTGAAATTTTTATTTCTTTCTATCAATGACCTCTCAGGACCCATTCCTTTCGATCTCGGTGATAGTCTACAATCCATCGAATATCTACATCTATCCAACAATAGTCTTTCAGATTTGACTAAACTTGA...

Protein

Download Protein FASTA

165 aa · TkA04G114500|TK1151|PROTEIN

MHERSICGFTGVECSENKNTVIRIQLIDSRLSGPFPIGIRNCTNLKFLFLSINDLSGPIPFDLGDSLQSIEYLHLSNNSLSDLTKLDRIKVFSVANNRLSGHVPMFGTGIYFYAESYANNTGLCGGPLNACKGDGVDDNFFLSGFVVGFSLFTILSMWFMFFCLP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G114500`
TK1151 ID	TkA04G114500
OH-1004 ID	LXL04_035703
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.500
Protein coverage (%)	TK1151 86.667 / OH-1004 27.135 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G114500`
Location	Chr04:29730106-29730690 (-)
Description	Similar to At5g48380: Probably inactive leucine-rich repeat receptor-like protein kinase At5g48380
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035703` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006952 defense response Biological Process GO:0009626 plant-type hypersensitive response Biological Process GO:0031348 negative regulation of defense response Biological Process GO:0042742 defense response to bacterium Biological Process GO:0045088 regulation of innate immune response Biological Process GO:1900150 regulation of defense response to fungus Biological Process GO:1900425 negative regulation of defense response to bacterium Biological Process GO:0005576 extracellular region Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009506 plasmodesma Cellular Component GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference	ath:AT1G69990 ath:AT3G28450 ath:AT5G48380 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.733

Rank 1 · TkA04G114500 · TK1151

Endoplasmic reticulum0.126

Rank 2 · TkA04G114500 · TK1151

Cytoplasm0.065

Rank 3 · TkA04G114500 · TK1151

Lysosome / Vacuole0.046

Rank 4 · TkA04G114500 · TK1151

Extracellular0.044

Rank 5 · TkA04G114500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13855LRR_823-55 aa

PF00560LRR_125-42 aa

PF12799LRR_439-56 aa

PF12799LRR_443-87 aa

PF00560LRR_144-64 aa

PF13855LRR_866-85 aa

PF12799LRR_469-99 aa

PF00560LRR_169-82 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G114500	`PF13855`	LRR_8	23	55	0.046	14.2
TkA04G114500	`PF00560`	LRR_1	25	42	2.6e-05	24.2
TkA04G114500	`PF12799`	LRR_4	39	56	1.3e-05	26.0
TkA04G114500	`PF12799`	LRR_4	43	87	1.3e-05	26.0
TkA04G114500	`PF00560`	LRR_1	44	64	2.6e-05	24.2
TkA04G114500	`PF13855`	LRR_8	66	85	0.046	14.2
TkA04G114500	`PF12799`	LRR_4	69	99	1.3e-05	26.0
TkA04G114500	`PF00560`	LRR_1	69	82	2.6e-05	24.2
TkA04G114500	`PF00560`	LRR_1	89	104	2.6e-05	24.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card