Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1288 bp · TkA04G114300|TK1151|cDNA
TGATAATCCAATAAAAAAATTATAGCCTAATACCTTGATTAAAATTAAAAATTTATAGCCCAATACCTAATTAAAACTAAAAATAAAGAAAATAAAAAAGAAAAACACCTGGCTGTCGACGTGATTACGCGAACGGGAGTGGGGGGAAATTGAAATTGCCGATTACACTTCTTCTCCAAACAACCGGCGAGAAGTCCGACTCCAGACAACCGCCACCGCGACGGCGCTGTGCGCCTGCGCCTACCTCCATCCCGGCCAGC...
924 bp · TkA04G114300|TK1151|CDS
ATGGTTTACACAGCTATTGATACGTTCTATCTAACCGATAAACAACTCAAGAACACACCATCAAGAAAAGATGGAATTGATGAGGCCACTGAAATCACACTCAGAAGATACGGCTGTGATCTTATAGTAGAGAGTGGCATTTTACTTAAGGTACCACAGCAGGTAATGGGCACGGGTCAAGTTTTATTTCATCGATTCTACTGCAAGCAATCATTTGCTTGTTTCAATGTCAAGAGAGTTGCTGCTAGTTGCATTTGGCT...
Protein
Download Protein FASTA307 aa · TkA04G114300|TK1151|PROTEIN
MVYTAIDTFYLTDKQLKNTPSRKDGIDEATEITLRRYGCDLIVESGILLKVPQQVMGTGQVLFHRFYCKQSFACFNVKRVAASCIWLASKLEENIRSVKQVLKAFHKMENLPIELFDVSSKKYSELETDLKRCELQVLKEMGYICHVELPHKLMTVYLGILQAPSHMTQEAWNLANDSLRTTLCVRFKSHVVACGVIYAAARRCYVPLPENPPWWKAFETSKKEIDEVCRVLAHLYSLPKPQYVHVCKEDGSFTMCLNDA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G114300 |
|---|---|
| TK1151 ID | TkA04G114300 |
| OH-1004 ID | LXL04_035711 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 97.400 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 95.639Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G114300 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:29655624-29658221 (-) | ||||||||||||
| Description | Similar to CYCL1-1: Cyclin-L1-1 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006397 mRNA processing Biological Process GO:0008380 RNA splicing Biological Process GO:0009651 response to salt stress Biological Process GO:0043484 regulation of RNA splicing Biological Process GO:0046605 regulation of centrosome cycle Biological Process GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process GO:0051301 cell division Biological Process GO:0051321 meiotic cell cycle Biological Process GO:0051726 regulation of cell cycle Biological Process | ||||||||||||
| KEGG gene cross-reference | ath:AT2G26430 dosa:Os01g0377500 hsa:81669 mmu:56036 rno:298686 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00134Cyclin_N11-142 aaPF00382TFIIB49-104 aaPF25635SPV1_VP1054-78 aaPF21797CycT2-like_C75-91 aaPF18382Formin_GBD_N79-131 aaPF03668RapZ-like_N133-171 aaPF21797CycT2-like_C150-220 aaPF18382Formin_GBD_N152-168 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G114300 | PF00134 | Cyclin_N | 11 | 142 | 1.4e-10 | 41.7 |
| TkA04G114300 | PF00382 | TFIIB | 49 | 104 | 0.002 | 18.9 |
| TkA04G114300 | PF25635 | SPV1_VP10 | 54 | 78 | 0.067 | 13.6 |
| TkA04G114300 | PF21797 | CycT2-like_C | 75 | 91 | 4.9e-08 | 33.4 |
| TkA04G114300 | PF18382 | Formin_GBD_N | 79 | 131 | 0.13 | 13.5 |
| TkA04G114300 | PF03668 | RapZ-like_N | 133 | 171 | 0.22 | 12.0 |
| TkA04G114300 | PF21797 | CycT2-like_C | 150 | 220 | 4.9e-08 | 33.4 |
| TkA04G114300 | PF18382 | Formin_GBD_N | 152 | 168 | 0.13 | 13.5 |
| TkA04G114300 | PF00382 | TFIIB | 162 | 205 | 0.002 | 18.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.