TkA04G113650 | RubberDandelionOmics

Gene overview

TkA04G113650

Reference: TK1151 Chr: Chr04 Coordinates: 29503012-29505176 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1144 bp · TkA04G113650|TK1151|cDNA

GAGAGATGCCAAACTGGACCAAAACTATAATCCGATTATTTACTCTGATAATTATTTCGCCATATTAGTTTTGTTAGCCGTTGGAAAATAGGTTTGCCCAAAAGAAGAAGAAACCACGCATAAAAGTCTTGCGGCTCGTCGCCCTATTGCCGCCGGCTGCATTGAAGAACAACCCTTAAATACTCTGCTAATTTGTCACTGTTCAAAGAGAGAGTGAGAATGCAAGAAAGAGAAGCTGAGGCAGAGATGGTCACACCAGG...

CDS

Download CDS FASTA

597 bp · TkA04G113650|TK1151|CDS

ATGCAAGAAAGAGAAGCTGAGGCAGAGATGGTCACACCAGGGGAAGTACTGGGGAAAGGAAGCGAAGTGAAACCAGGCAAGGGAGCATACTTATCACATCACAATAACACCGTCTACGCCTCCCTCACCGGCCGCCGTTCCCTGGCCCCTGCGTCACCTGAATCTCCAGACCAGAGGCCAACTGTGGAAGTGATTGGACACAAAGCCCATGGTCCAGTTCCTGAGCCAGGCTGTGTTGTCATCGCTCGAGTAACTAAGGT...

Protein

Download Protein FASTA

198 aa · TkA04G113650|TK1151|PROTEIN

MQEREAEAEMVTPGEVLGKGSEVKPGKGAYLSHHNNTVYASLTGRRSLAPASPESPDQRPTVEVIGHKAHGPVPEPGCVVIARVTKVMAKMASVDIMCVSSKSVREKFSGVIRQQDVRATEIDKVDMHSSFRPGDIVKALVLSLGDARAYYLSTAQNELGVVSAESMSGGTMVPISWTEMQCPLTGQIEQRKVAKVGA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G113650`
TK1151 ID	TkA04G113650
OH-1004 ID	LXL04_035722
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G113650`
Location	Chr04:29503012-29505176 (+)
Description	Similar to EXOSC1: Exosome complex component CSL4
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035722` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000467 exonucleolytic trimming to generate mature 3'-end of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000956 nuclear-transcribed mRNA catabolic process Biological Process GO:0006364 rRNA processing Biological Process GO:0006396 RNA processing Biological Process GO:0006397 mRNA processing Biological Process GO:0006401 RNA catabolic process Biological Process GO:0070478 nuclear-transcribed mRNA catabolic process, 3'-5' exonucleolytic nonsense-mediated decay Biological Process GO:0070481 nuclear-transcribed mRNA catabolic process, non-stop decay Biological Process GO:0070651 nonfunctional rRNA decay Biological Process GO:0071028 nuclear mRNA surveillance Biological Process GO:0071035 nuclear polyadenylation-dependent rRNA catabolic process Biological Process GO:0071038 TRAMP-dependent tRNA surveillance pathway Biological Process
KEGG gene cross-reference	cel:CELE_Y48A6B.5 hsa:51013 mmu:66583 sce:YNL232W spo:2539351 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.715

Rank 1 · TkA04G113650 · TK1151

Cytoplasm0.317

Rank 2 · TkA04G113650 · TK1151

Mitochondrion0.070

Rank 3 · TkA04G113650 · TK1151

Cell membrane0.034

Rank 4 · TkA04G113650 · TK1151

Endoplasmic reticulum0.025

Rank 5 · TkA04G113650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10447EXOSC13-16 aa

PF22625ECR1_N_29-44 aa

PF14382ECR1_N10-47 aa

PF10447EXOSC173-101 aa

PF21266S1_RRP474-140 aa

PF10447EXOSC1101-144 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G113650	`PF10447`	EXOSC1	3	16	1.6e-16	61.8
TkA04G113650	`PF22625`	ECR1_N_2	9	44	0.0031	18.0
TkA04G113650	`PF14382`	ECR1_N	10	47	8.6e-10	38.9
TkA04G113650	`PF10447`	EXOSC1	73	101	1.6e-16	61.8
TkA04G113650	`PF21266`	S1_RRP4	74	140	3.2e-05	24.8
TkA04G113650	`PF10447`	EXOSC1	101	144	1.6e-16	61.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card