TkA04G108400 | RubberDandelionOmics

Gene overview

TkA04G108400

Reference: TK1151 Chr: Chr04 Coordinates: 28165742-28168271 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1243 bp · TkA04G108400|TK1151|cDNA

TTATAAATAAGGTTAAGCAGAAGGGAAAAAAAAAAAAAAAAACCAGTAAGCAAATATAACTGACGAAAATGTCGACCATCACTGTTCCGTCACATGCTACCTCCATCACCGACGACGTTGATCAGCTCCATAACGCTTTCTCAGGATTTGGAACAAACGAGAAATTGATCATTTCAATTTTGGCCCACCGCGATGCTGAACAACGGAAACAAATCCGCGACACTTACGCTGCAACCTACAAGGAAGATCTCCTCAAATCA...

CDS

Download CDS FASTA

951 bp · TkA04G108400|TK1151|CDS

ATGTCGACCATCACTGTTCCGTCACATGCTACCTCCATCACCGACGACGTTGATCAGCTCCATAACGCTTTCTCAGGATTTGGAACAAACGAGAAATTGATCATTTCAATTTTGGCCCACCGCGATGCTGAACAACGGAAACAAATCCGCGACACTTACGCTGCAACCTACAAGGAAGATCTCCTCAAATCACTCGACAAGGAACTCTCAAATGACTTCGAGAGGCTTGTCCATCTGTGGACACTCAGTCCTCCAGAACG...

Protein

Download Protein FASTA

316 aa · TkA04G108400|TK1151|PROTEIN

MSTITVPSHATSITDDVDQLHNAFSGFGTNEKLIISILAHRDAEQRKQIRDTYAATYKEDLLKSLDKELSNDFERLVHLWTLSPPERDAVLINEATKRWTKSNQVLVEIACTRSSHDLLLAKQAYHARFKKSMEEDIAYHTTEDFRKLMLPLIATCRYDGSEVNMTLAKTEAKILHEKIKDKCLNDDEFIRILTTRSKSQINATLNQFKNLYGEDIIKELEEDSKDEYTSLVRATLECLTYPEKYFERVLRLAINKTGTD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G108400`
TK1151 ID	TkA04G108400
OH-1004 ID	LXL04_035794
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G108400

Location Chr04:28165742-28168271 (-)

Description Similar to ANN2: Annexin D2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65020`	May mediate regulated, targeted secretion of Golgi-derived vesicles during seedling development.	No verified direct reference in this release
`At1g35720`	Has a peroxidase activity.	Immunolocalization and histochemical evidence for the association of two different Arabidopsis annexins with secretion during early seedling growth and development.2005 · DOI: 10.1007/s00425-004-1374-7 Peroxidase activity of annexin 1 from Arabidopsis thaliana.2005 · DOI: 10.1016/j.bbrc.2005.08.181
`At5g10230`	Annexin D7.	No verified direct reference in this release
`At5g10220`	Annexin D6.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035794 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009835 fruit ripening Biological Process

GO:0015774 polysaccharide transport Biological Process

GO:0017156 calcium-ion regulated exocytosis Biological Process

GO:0032940 secretion by cell Biological Process

KEGG gene cross-reference

ath:AT1G35720

ath:AT5G10220

ath:AT5G10230

ath:AT5G65020

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.513

Rank 1 · TkA04G108400 · TK1151

Cell membrane0.300

Rank 2 · TkA04G108400 · TK1151

Nucleus0.211

Rank 3 · TkA04G108400 · TK1151

Extracellular0.085

Rank 4 · TkA04G108400 · TK1151

Mitochondrion0.071

Rank 5 · TkA04G108400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15963Myb_DNA-bind_715-55 aa

PF00191Annexin16-78 aa

PF00940RNA_pol46-102 aa

PF24360DUF751646-64 aa

PF00191Annexin87-152 aa

PF15963Myb_DNA-bind_794-127 aa

PF24360DUF7516123-136 aa

PF00191Annexin171-233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G108400	`PF15963`	Myb_DNA-bind_7	15	55	0.16	12.5
TkA04G108400	`PF00191`	Annexin	16	78	4.5e-70	232.4
TkA04G108400	`PF00940`	RNA_pol	46	102	0.11	11.9
TkA04G108400	`PF24360`	DUF7516	46	64	0.24	12.2
TkA04G108400	`PF00191`	Annexin	87	152	4.5e-70	232.4
TkA04G108400	`PF15963`	Myb_DNA-bind_7	94	127	0.16	12.5
TkA04G108400	`PF24360`	DUF7516	123	136	0.24	12.2
TkA04G108400	`PF00191`	Annexin	171	233	4.5e-70	232.4
TkA04G108400	`PF00940`	RNA_pol	206	232	0.11	11.9
TkA04G108400	`PF00191`	Annexin	246	310	4.5e-70	232.4
TkA04G108400	`PF15963`	Myb_DNA-bind_7	253	302	0.16	12.5
TkA04G108400	`PF24360`	DUF7516	268	295	0.24	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XEE2`	Arabidopsis thaliana	sp\|Q9XEE2\|ANXD2_ARATH Annexin D2	66.500%	Swiss-Prot	High
`Q9SYT0`	Arabidopsis thaliana	sp\|Q9SYT0\|ANXD1_ARATH Annexin D1	65.800%	Swiss-Prot	High
`Q9LX07`	Arabidopsis thaliana	sp\|Q9LX07\|ANXD7_ARATH Annexin D7	65.400%	Swiss-Prot	High
`Q9LX08`	Arabidopsis thaliana	sp\|Q9LX08\|ANXD6_ARATH Annexin D6	62.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card