TkA04G082290 | RubberDandelionOmics

Gene overview

TkA04G082290

Reference: TK1151 Chr: Chr04 Coordinates: 21559078-21569058 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1125 bp · TkA04G082290|TK1151|cDNA

ATGGAAAATGATGTAATGGAACTCGAATCCCAAACAGGAGTGGAGGATCTACTGAAGGCGTATGCAAACGCCATGGAAATGGGACAGAAAGAGCTTGCGAACGTGATTGTGACATGTATATGTGAAAAAATAAACCCTATAGGTCCGGCCATTGATCGCATAGCTTTTAATTTGTTCAAAAGTGCAGAAAATCAAGGAGACGAGTACCTTAAAGAAGAGCTAATGAGAAACTTCAAGCCGGCATTCAGAGCCTTCTACGA...

CDS

Download CDS FASTA

1125 bp · TkA04G082290|TK1151|CDS

ATGGAAAATGATGTAATGGAACTCGAATCCCAAACAGGAGTGGAGGATCTACTGAAGGCGTATGCAAACGCCATGGAAATGGGACAGAAAGAGCTTGCGAACGTGATTGTGACATGTATATGTGAAAAAATAAACCCTATAGGTCCGGCCATTGATCGCATAGCTTTTAATTTGTTCAAAAGTGCAGAAAATCAAGGAGACGAGTACCTTAAAGAAGAGCTAATGAGAAACTTCAAGCCGGCATTCAGAGCCTTCTACGA...

Protein

Download Protein FASTA

374 aa · TkA04G082290|TK1151|PROTEIN

MENDVMELESQTGVEDLLKAYANAMEMGQKELANVIVTCICEKINPIGPAIDRIAFNLFKSAENQGDEYLKEELMRNFKPAFRAFYDIFPYGRFVHFTANSAILEAVPSDVESIHIVDFDLGEGTQWPPVIEAVAQKRKSLTLTITSVKIEERDFNFEETKRHLCDYARDVGVNLKVQEVELGQLEMELAQLVKIRGEFTAFNCMVGLPHMGRTRKRTQVLEFLKIAKGILAKNKGIVIFADGEEFERRGNFNDYVSFFN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G082290`
TK1151 ID	TkA04G082290
OH-1004 ID	LXL04_036041
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	79.800
Protein coverage (%)	TK1151 99.465 / OH-1004 34.608 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G082290

Location Chr04:21559078-21569058 (-)

Description Similar to NSP2: Protein NODULATION SIGNALING PATHWAY 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g55580`	Probable transcription factor required for axillary (lateral) shoot meristem formation during vegetative development.	No verified direct reference in this release
`At2g29060`	Probable transcription factor involved in plant development.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0127800`	Probable transcription factor that acts as a positive regulator of brassinosteroid (BR) signaling.	SMALL ORGAN SIZE 1 and SMALL ORGAN SIZE 2/DWARF AND LOW-TILLERING Form a Complex to Integrate Auxin and Brassinosteroid Signaling in Rice.2017 · DOI: 10.1016/j.molp.2016.12.013
`Os01g0646300`	Probable transcriptional regulator that acts as a repressor of the gibberellin (GA) signaling pathway.	Overexpression of a GRAS protein lacking the DELLA domain confers altered gibberellin responses in rice.2005 · DOI: 10.1111/j.1365-313x.2005.02562.x
`Os06g0610300`	Putative transcription regulator that controls rice tillering by initiating axillary buds and promoting their outgrowth.	Control of tillering in rice.2003 · DOI: 10.1038/nature01518

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036041 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009877 nodulation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0031965 nuclear membrane Cellular Component

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G08250

mtr:11406790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.604

Rank 1 · TkA04G082290 · TK1151

Nucleus0.438

Rank 2 · TkA04G082290 · TK1151

Cell membrane0.073

Rank 3 · TkA04G082290 · TK1151

Endoplasmic reticulum0.057

Rank 4 · TkA04G082290 · TK1151

Plastid0.042

Rank 5 · TkA04G082290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03514GRAS15-373 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G082290	`PF03514`	GRAS	15	373	2.3e-45	155.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZWC5`	Arabidopsis thaliana	sp\|Q9ZWC5\|SCL18_ARATH Scarecrow-like protein 18	27.700%	Swiss-Prot	Low
`P0C883`	Arabidopsis thaliana	sp\|P0C883\|SCL33_ARATH Scarecrow-like protein 33	20.800%	Swiss-Prot	Low
`Q9LWU9`	Oryza sativa subsp. japonica	sp\|Q9LWU9\|DLT_ORYSJ Protein DWARF AND LOW-TILLERING	23.500%	Swiss-Prot	Low
`B7F9I5`	Oryza sativa subsp. japonica	sp\|B7F9I5\|SLRL1_ORYSJ Protein SLENDER RICE1-LIKE 1	27.000%	Swiss-Prot	Low
`Q84MM9`	Oryza sativa subsp. japonica	sp\|Q84MM9\|MOC_ORYSJ Protein MONOCULM 1	24.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card