TkA04G079180 | RubberDandelionOmics

Gene overview

TkA04G079180

Reference: TK1151 Chr: Chr04 Coordinates: 20770082-20774328 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2367 bp · TkA04G079180|TK1151|cDNA

GTCATATGACCAAAATACCCTCCATCTCCCACTCCTATTTCATTCCTTCCAATGCCTCCATTCTCACCAACCCCATTCAAATCTATCGATCAATGACGACGCTGTTCATCTCATTCAGAACTATACTCGCTGTACACGATTGCTCCCATACCCATTAAGTAATTAATCTCAAATTAAGTCGTAGTGTCAGCCATGGCTGCCGCAGCCGGAAACGCCGCCGTTACTTCTAAAGCTCCTGCATTCGGCGCAAGATCTTCAAA...

CDS

Download CDS FASTA

1551 bp · TkA04G079180|TK1151|CDS

ATGGCTGCCGCAGCCGGAAACGCCGCCGTTACTTCTAAAGCTCCTGCATTCGGCGCAAGATCTTCAAAGATTTCCGATGCCCATTTGAATTCGGTTCGTTTCAGGAAACCCCTTTTCGGATTTCGATATAATATTGAACGGAAATGGGGGAATTTGTCACTGCAAGGTGGCGGCGCGAGGAACATAGAGGCGATTGTAGAGAGAGGGAAAAAAAGTAGGGGGTTGGTGAAGTGTACGGCGGAGGGGATCGAGAGAGGAAT...

Protein

Download Protein FASTA

516 aa · TkA04G079180|TK1151|PROTEIN

MAAAAGNAAVTSKAPAFGARSSKISDAHLNSVRFRKPLFGFRYNIERKWGNLSLQGGGARNIEAIVERGKKSRGLVKCTAEGIERGILTGGRGQEGTFVMPERLKVVALMACVMCLCNADRVVMSVAIVPLAAKHGWSSSFLGIVQSSFLWGYIFSSVIGGALVDKYGGKRVIAWGVALWSLATLLTPWAANHSTIALLAVRAFFGLAEGVALPSMNILLSKWFPCNERATAVGLSMGGFHLGNVVGLVLTPIVMSSVGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G079180`
TK1151 ID	TkA04G079180
OH-1004 ID	LXL04_036058
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G079180

Location Chr04:20770082-20774328 (-)

Description Similar to ANTR3: Probable anion transporter 3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38060`	Inorganic phosphate and probable anion transporter.	No verified direct reference in this release
`At3g46980`	Inorganic phosphate and probable anion transporter.	No verified direct reference in this release
`At2g29650`	Specific for inorganic phosphate transport across the thylakoid membrane in a sodium dependent manner.	Arabidopsis ANTR1 is a thylakoid Na+-dependent phosphate transporter: functional characterization in Escherichia coli.2008 · DOI: 10.1074/jbc.m709371200

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0451100`	Probable anion transporter.	No verified direct reference in this release
`Os01g0852200`	Probable anion transporter.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036058 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006811 monoatomic ion transport Biological Process

GO:0006814 sodium ion transport Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009624 response to nematode Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0005315 phosphate transmembrane transporter activity Molecular Function

GO:0015293 symporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G29650

ath:AT2G38060

ath:AT3G46980

dosa:Os01g0852200

dosa:Os05g0451100

osa:4324813

osa:4338960

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.948

Rank 1 · TkA04G079180 · TK1151

Mitochondrion0.034

Rank 2 · TkA04G079180 · TK1151

Golgi apparatus0.027

Rank 3 · TkA04G079180 · TK1151

Peroxisome0.025

Rank 4 · TkA04G079180 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA04G079180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07690MFS_1112-474 aa

PF00083Sugar_tr138-273 aa

PF07690MFS_1402-506 aa

PF00083Sugar_tr458-511 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G079180	`PF07690`	MFS_1	112	474	9.1e-49	166.9
TkA04G079180	`PF00083`	Sugar_tr	138	273	9.8e-07	28.7
TkA04G079180	`PF07690`	MFS_1	402	506	9.1e-49	166.9
TkA04G079180	`PF00083`	Sugar_tr	458	511	9.8e-07	28.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7XJR2`	Arabidopsis thaliana	sp\|Q7XJR2\|ANTR3_ARATH Probable anion transporter 3, chloroplastic	71.900%	Swiss-Prot	High
`Q66GI9`	Arabidopsis thaliana	sp\|Q66GI9\|ANTR4_ARATH Probable anion transporter 4, chloroplastic	60.000%	Swiss-Prot	High
`O82390`	Arabidopsis thaliana	sp\|O82390\|ANTR1_ARATH Sodium-dependent phosphate transport protein 1, chloroplastic	42.700%	Swiss-Prot	Medium
`Q53WP9`	Oryza sativa subsp. japonica	sp\|Q53WP9\|PHT42_ORYSJ Probable anion transporter 2, chloroplastic	65.300%	Swiss-Prot	High
`Q8W0H5`	Oryza sativa subsp. japonica	sp\|Q8W0H5\|PHT43_ORYSJ Probable anion transporter 3, chloroplastic	58.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card