TkA04G071870 | RubberDandelionOmics

Gene overview

TkA04G071870

Reference: TK1151 Chr: Chr04 Coordinates: 19029362-19038170 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2630 bp · TkA04G071870|TK1151|cDNA

TTAACAACTACAAATTTGATCGTCAACTGAAGCTGTTTAGAGTTGGAAGGTTCAACGACAACACGATATGATTAAACTCATTCAAACCCATTCTAAAATTCAACTCTCACATGTCCTTCACGCAATCCATGGAAAAGTTCTTTGTTACAAACCTCATCTACCCATTATCGTATTCGTTAACACAATAAAATACTTAGGGGCAAGTTATTTTCTTTATATATACCGAACGTATGGAACCAAGTCATTTACAAATCTAAACT...

CDS

Download CDS FASTA

1911 bp · TkA04G071870|TK1151|CDS

ATGATTAAACTCATTCAAACCCATTCTAAAATTCAACTCTCACATGTCCTTCACGCAATCCATGGAAAAGTTCTTTGTTACAAACCTCATCTACCCATTATCGTATTCGTTAACACAATAAAATACTTAGGGGCAAGTTATTTTCTTTATATATACCGAACGTATGGAACCAAGTCATTTACAAATCTAAACTTTTCGACAATGGGTTCTTGGCTGTTCTCCATTGGGATCCTGCTAGCTTTTCTCTCTTTTTCTTTGTC...

Protein

Download Protein FASTA

636 aa · TkA04G071870|TK1151|PROTEIN

MIKLIQTHSKIQLSHVLHAIHGKVLCYKPHLPIIVFVNTIKYLGASYFLYIYRTYGTKSFTNLNFSTMGSWLFSIGILLAFLSFSLSTTSGAIVETSFQVKNLTTSRLCQNHVIVAVNGSLPGPTLRVKEGDTLIVHVFNQSPYNLTIHWHGVFQMRSQWMDGPEYVTQCPIMPGNSYTYRFNLTGQVGTLWWHAHTQWLRATVYGALIIRPRDGQKYPFVKPYREKTILLGEWWNANVIDVETSALVTGVSPNNSDAYT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G071870`
TK1151 ID	TkA04G071870
OH-1004 ID	LXL04_036140
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	85.500
Protein coverage (%)	TK1151 99.843 / OH-1004 87.737 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G071870

Location Chr04:19029362-19038170 (-)

Description Similar to LAC7: Laccase-7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g09220`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At5g01050`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At5g01040`	Lignin degradation and detoxification of lignin-derived products (By similarity).	Mutant identification and characterization of the laccase gene family in Arabidopsis.2006 · DOI: 10.1093/jxb/erl022

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0258700`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`Os12g0259800`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036140 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0046274 lignin catabolic process Biological Process

GO:0046688 response to copper ion Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0048046 apoplast Cellular Component

GO:0005507 copper ion binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0052716 hydroquinone:oxygen oxidoreductase activity Molecular Function

KEGG gene cross-reference

ath:AT3G09220

ath:AT5G01040

ath:AT5G01050

ath:AT5G05390

dosa:Os12g0259800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.589

Rank 1 · TkA04G071870 · TK1151

Cytoplasm0.106

Rank 2 · TkA04G071870 · TK1151

Cell membrane0.105

Rank 3 · TkA04G071870 · TK1151

Endoplasmic reticulum0.095

Rank 4 · TkA04G071870 · TK1151

Lysosome / Vacuole0.076

Rank 5 · TkA04G071870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07732Cu-oxidase_3100-214 aa

PF00394Cu-oxidase120-195 aa

PF07731Cu-oxidase_2121-199 aa

PF07731Cu-oxidase_2193-233 aa

PF00394Cu-oxidase227-378 aa

PF07732Cu-oxidase_3280-347 aa

PF07731Cu-oxidase_2308-350 aa

PF07731Cu-oxidase_2482-618 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G071870	`PF07732`	Cu-oxidase_3	100	214	4.6e-43	146.8
TkA04G071870	`PF00394`	Cu-oxidase	120	195	6.4e-41	140.8
TkA04G071870	`PF07731`	Cu-oxidase_2	121	199	1.1e-45	155.5
TkA04G071870	`PF07731`	Cu-oxidase_2	193	233	1.1e-45	155.5
TkA04G071870	`PF00394`	Cu-oxidase	227	378	6.4e-41	140.8
TkA04G071870	`PF07732`	Cu-oxidase_3	280	347	4.6e-43	146.8
TkA04G071870	`PF07731`	Cu-oxidase_2	308	350	1.1e-45	155.5
TkA04G071870	`PF07731`	Cu-oxidase_2	482	618	1.1e-45	155.5
TkA04G071870	`PF00394`	Cu-oxidase	488	600	6.4e-41	140.8
TkA04G071870	`PF07732`	Cu-oxidase_3	518	545	4.6e-43	146.8
TkA04G071870	`PF07732`	Cu-oxidase_3	579	618	4.6e-43	146.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SR40`	Arabidopsis thaliana	sp\|Q9SR40\|LAC7_ARATH Laccase-7	61.300%	Swiss-Prot	High
`Q9LFD1`	Arabidopsis thaliana	sp\|Q9LFD1\|LAC9_ARATH Laccase-9	56.000%	Swiss-Prot	High
`Q9LFD2`	Arabidopsis thaliana	sp\|Q9LFD2\|LAC8_ARATH Laccase-8	55.900%	Swiss-Prot	High
`Q2QUN2`	Oryza sativa subsp. japonica	sp\|Q2QUN2\|LAC24_ORYSJ Laccase-24	56.700%	Swiss-Prot	High
`Q0IP28`	Oryza sativa subsp. japonica	sp\|Q0IP28\|LAC25_ORYSJ Laccase-25	54.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card