TkA04G058290 | RubberDandelionOmics

Gene overview

TkA04G058290

Reference: TK1151 Chr: Chr04 Coordinates: 15532298-15540072 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5758 bp · TkA04G058290|TK1151|cDNA

CTAAACCCCTATGCCATCTCTTTAACCGGTACCTTGCAATTTTGCAAATCGCGAGAAACCCTCAGCCATCACTAAACCTCTCAGTCGTTGGCCGCCCTGTTGCGCCTCCGCCCTTCTCCATCACCACTCTGCTCTCATTCCACAGCTTTGCTCCACCCTAGCGCCGCGGCGTGTTCTCTGCGGCCGTAAAGTTGGAAATAAGTATTTCCAACTTTCAATTTCGGAACTGCTATTCCTGCGGCTGCGCCTATCGTTGTTGC...

CDS

Download CDS FASTA

3000 bp · TkA04G058290|TK1151|CDS

ATGGCTCAGACCACCGAGGGTGCGTCTGAGATAGTTGAGGGTGTAAGGTTCAGTTTCATGACTGATGAAGAGGTCAGGAAACATAGTGTCTTAAAGATCACAAACCCTATTTTACTCGACAATGTTGGAAGACCAATGCCAGGAGGACTGTACGATCCTTTATTGGGCCCAATAGATGAACAAGCACCTTGTAAATCATGTGGGCAGCAGTCGTTTCAATGCTCAGGTCATTGTGGTCACATTGATCTCGTTTCACCACT...

Protein

Download Protein FASTA

999 aa · TkA04G058290|TK1151|PROTEIN

MAQTTEGASEIVEGVRFSFMTDEEVRKHSVLKITNPILLDNVGRPMPGGLYDPLLGPIDEQAPCKSCGQQSFQCSGHCGHIDLVSPLYNPLLFDILFTLLRRTCFFCRHFTAGKEEVDTCTSKLIMITKGDVAGAKDYVINNSDTKDIDLEDNDGSHASNSTLHSGSQSGTPEQSPHDFWTSVQYVEAKSVLKEFLANPSRSCKNCEAKNPKITKPTFGSFCMEMTFADAEKNHMRGYKLGGMQDEDFQEEENDKTSEVI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G058290`
TK1151 ID	TkA04G058290
OH-1004 ID	LXL04_036287
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.398 / OH-1004 59.684 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G058290

Location Chr04:15532298-15540072 (+)

Description Similar to NRPA1: DNA-directed RNA polymerase I subunit 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g57660`	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036287 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001172 RNA-templated transcription Biological Process

GO:0006360 transcription by RNA polymerase I Biological Process

GO:0006361 transcription initiation at RNA polymerase I promoter Biological Process

GO:0006362 transcription elongation by RNA polymerase I Biological Process

GO:0006363 termination of RNA polymerase I transcription Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0042790 nucleolar large rRNA transcription by RNA polymerase I Biological Process

GO:1904750 negative regulation of protein localization to nucleolus Biological Process

GO:0000785 chromatin Cellular Component

GO:0001650 fibrillar center Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G57660

ddi:DDB_G0275759

hsa:25885

sce:YOR341W

spo:2540873

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.929

Rank 1 · TkA04G058290 · TK1151

Cytoplasm0.128

Rank 2 · TkA04G058290 · TK1151

Cell membrane0.022

Rank 3 · TkA04G058290 · TK1151

Mitochondrion0.022

Rank 4 · TkA04G058290 · TK1151

Endoplasmic reticulum0.010

Rank 5 · TkA04G058290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04997RNA_pol_Rpb1_111-454 aa

PF00623RNA_pol_Rpb1_2457-641 aa

PF04983RNA_pol_Rpb1_3645-846 aa

PF04997RNA_pol_Rpb1_1745-780 aa

PF05000RNA_pol_Rpb1_4891-984 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G058290	`PF04997`	RNA_pol_Rpb1_1	11	454	2.7e-34	119.6
TkA04G058290	`PF00623`	RNA_pol_Rpb1_2	457	641	1.4e-58	198.6
TkA04G058290	`PF04983`	RNA_pol_Rpb1_3	645	846	3.8e-32	112.1
TkA04G058290	`PF04997`	RNA_pol_Rpb1_1	745	780	2.7e-34	119.6
TkA04G058290	`PF05000`	RNA_pol_Rpb1_4	891	984	9e-18	64.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SVY0`	Arabidopsis thaliana	sp\|Q9SVY0\|NRPA1_ARATH DNA-directed RNA polymerase I subunit 1	53.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card