TkA04G057670 | RubberDandelionOmics

Gene overview

TkA04G057670

Reference: TK1151 Chr: Chr04 Coordinates: 15369119-15373581 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2296 bp · TkA04G057670|TK1151|cDNA

TAATAGTTAACTTAATAATAAAAAAATTGACTTAAATACTCGACTTAATAACGTTAAACATGCCATAACAACGAACATAACTAAAGATGATCAAGATTATCATCGGGGGGACATATTATGATCAAGATTATCAAACGTCCAAAGATAATCAGACGGGTGCAAAGTTGGATATGTTCTCGTTCTTTGTACATATTCATGACTACCGATTTCAAATGGTTGTGTATCGGTGATTACTTCATTCTCACCGTGGTGACATATAA...

CDS

Download CDS FASTA

888 bp · TkA04G057670|TK1151|CDS

ATGAGTTTGGAATCGTTTGAGTTTGTGGATGAAGAGATTCAGAACCTGATGTCGGCGGAACCACGGCTGGAGACTGGGAATTCGTTCACAGCTCTTCTCGAACTTCCACGAAATCAAGCGGTGAAGCTTCTACACTCGCCGGAGGAAGCAACACCAAACGTTCTCCCCTCCGTATTGTCGGCGACGGCGAAGGGGAATTCGCCGGAGACGACAAGCTCGTTTCTAATTCTACCAAATCCGAGCTGTAATACCAGTAATCC...

Protein

Download Protein FASTA

295 aa · TkA04G057670|TK1151|PROTEIN

MSLESFEFVDEEIQNLMSAEPRLETGNSFTALLELPRNQAVKLLHSPEEATPNVLPSVLSATAKGNSPETTSSFLILPNPSCNTSNPVKQEPLESGSLPNSPPISDPIISNSTKRKNREKTVILTAKKIKTAAKEAEREKLPYVHVRARRGEATDSHSLAERARREKINARMKLLQELVPGCNKVSGTAMVLNEIINHVQTLQLQVEFLSMKLATVHPRVDINLDSMFSSESGDSNFTGMVSQSWWQDEQANGNTQQIWH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G057670`
TK1151 ID	TkA04G057670
OH-1004 ID	LXL04_036295
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G057670

Location Chr04:15369119-15373581 (-)

Description Similar to BHLH48: Transcription factor bHLH48

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g42300`	Transcription factor bHLH48.	No verified direct reference in this release
`At3g57800`	Transcription factor bHLH60.	No verified direct reference in this release
`At3g07340`	Transcription factor bHLH62.	No verified direct reference in this release
`At3g23690`	Transcription factor bHLH77.	No verified direct reference in this release
`At4g34530`	Transcription factor that binds DNA to G box 5'-CACGTG-3' and, to a lower extent, to E-box 5'-CANNTG-3' in vitro.	Photoexcited CRY2 interacts with CIB1 to regulate transcription and floral initiation in Arabidopsis.2008 · DOI: 10.1126/science.1163927 Multiple bHLH proteins form heterodimers to mediate CRY2-dependent regulation of flowering-time in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003861

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036295 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009637 response to blue light Biological Process

GO:0009908 flower development Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0045824 negative regulation of innate immune response Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT1G68920

ath:AT2G42300

ath:AT3G23690

ath:AT3G57800

ath:AT4G34530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.962

Rank 1 · TkA04G057670 · TK1151

Cytoplasm0.126

Rank 2 · TkA04G057670 · TK1151

Cell membrane0.027

Rank 3 · TkA04G057670 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA04G057670 · TK1151

Plastid0.011

Rank 5 · TkA04G057670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23177bHLH_IRO3118-139 aa

PF00010HLH156-203 aa

PF23177bHLH_IRO3156-210 aa

PF23173bHLH_SAC51161-204 aa

PF23176bHLH_LHW165-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G057670	`PF23177`	bHLH_IRO3	118	139	0.067	14.3
TkA04G057670	`PF00010`	HLH	156	203	3.6e-07	30.6
TkA04G057670	`PF23177`	bHLH_IRO3	156	210	0.067	14.3
TkA04G057670	`PF23173`	bHLH_SAC51	161	204	0.00011	22.7
TkA04G057670	`PF23176`	bHLH_LHW	165	203	0.082	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZ02`	Arabidopsis thaliana	sp\|Q8VZ02\|BH048_ARATH Transcription factor bHLH48	50.000%	Swiss-Prot	High
`Q3EAI1`	Arabidopsis thaliana	sp\|Q3EAI1\|BH060_ARATH Transcription factor bHLH60	37.700%	Swiss-Prot	Medium
`Q9SRT2`	Arabidopsis thaliana	sp\|Q9SRT2\|BH062_ARATH Transcription factor bHLH62	70.800%	Swiss-Prot	Low
`Q9LK48`	Arabidopsis thaliana	sp\|Q9LK48\|BH077_ARATH Transcription factor bHLH77	70.800%	Swiss-Prot	Low
`Q8GY61`	Arabidopsis thaliana	sp\|Q8GY61\|BH063_ARATH Transcription factor bHLH63	66.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card