TkA04G056920 | RubberDandelionOmics

Gene overview

TkA04G056920

Reference: TK1151 Chr: Chr04 Coordinates: 15180432-15182264 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1768 bp · TkA04G056920|TK1151|cDNA

CAGAGATCCAAGTGGTTTCATTTTCTACAAATTAAGCAAACTTTCTTCTCTTCACTTCCACTATGGCCGATCTTCAAGGCTACTTCATCCTCTTTCTCATAATTTCCATATCCACTTTCCTTATACGTGCCCTATACAAGTCTAAATCTGGCATTCCTCCGAGCCCATTTGCCCTGCCCATCATCGGGCACCTCCACCTCCTTGGTCCAAGCCCACATCAAGCTTTTCACAAACTTTCTATCCAATATGGCCCAGTTTTT...

CDS

Download CDS FASTA

1509 bp · TkA04G056920|TK1151|CDS

ATGGCCGATCTTCAAGGCTACTTCATCCTCTTTCTCATAATTTCCATATCCACTTTCCTTATACGTGCCCTATACAAGTCTAAATCTGGCATTCCTCCGAGCCCATTTGCCCTGCCCATCATCGGGCACCTCCACCTCCTTGGTCCAAGCCCACATCAAGCTTTTCACAAACTTTCTATCCAATATGGCCCAGTTTTTCGCCTCTTTCTCGGCTCCAAACCCTGCGTTGTTTTCAATTCACCACAAACTGCAAAAGAATT...

Protein

Download Protein FASTA

502 aa · TkA04G056920|TK1151|PROTEIN

MADLQGYFILFLIISISTFLIRALYKSKSGIPPSPFALPIIGHLHLLGPSPHQAFHKLSIQYGPVFRLFLGSKPCVVFNSPQTAKELFRTYDNLFLDRPHNSAAEYIAYEGRGFIFSPYGSYWKFLKKIVVSELLNSKTLDSLIPVRRDEITRFLTSLSHKAKNGKSVELEGELMKMTNNVISRMLMSKRFSDEEDEAREIKKIITDIAELMFTFNLSDHIWFLHNLDIQGIGKRAKEIRGRFDVLIEKIIEKHEEARKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G056920`
TK1151 ID	TkA04G056920
OH-1004 ID	LXL04_036310
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.500
Protein coverage (%)	TK1151 94.821 / OH-1004 49.128 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G056920`
Location	Chr04:15180432-15182264 (+)
Description	Similar to CYP93A2: Cytochrome P450 93A2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036310` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006952 defense response Biological Process GO:0016020 membrane Cellular Component GO:0005506 iron ion binding Molecular Function GO:0016709 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen Molecular Function GO:0020037 heme binding Molecular Function GO:0047082 3,9-dihydroxypterocarpan 6a-monooxygenase activity Molecular Function
KEGG gene cross-reference	gmx:100776878 gmx:100797067 gmx:100815706 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.931

Rank 1 · TkA04G056920 · TK1151

Cell membrane0.035

Rank 2 · TkA04G056920 · TK1151

Cytoplasm0.033

Rank 3 · TkA04G056920 · TK1151

Plastid0.027

Rank 4 · TkA04G056920 · TK1151

Golgi apparatus0.021

Rank 5 · TkA04G056920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p45032-484 aa

PF04945YHS102-127 aa

PF27494Y4lK287-340 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G056920	`PF00067`	p450	32	484	5e-112	375.7
TkA04G056920	`PF04945`	YHS	102	127	0.25	12.1
TkA04G056920	`PF27494`	Y4lK	287	340	0.046	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card