TkA04G053940 | RubberDandelionOmics

Gene overview

TkA04G053940

Reference: TK1151 Chr: Chr04 Coordinates: 14407493-14409211 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

552 bp · TkA04G053940|TK1151|cDNA

ATGCCTTTGTATCGACACCTCCACCAGTTACATCTTAAATCCCTTCAACAGGGGTTCAGCAAATCTCTTGCCAGGACCGTGATTATAGATGGGAGAAAGCGGATTTTGCAGTCTGGATCCATTCATTATCCTCGAGCCACTCCCGAAATGTGGTCAGATATCATTGGGAAGGCAAAAGAAGGAGGATTGGATGTTATCGAGACTTATGTTTTCTGGAATTACCATGAGCCTGTTAAGAATGGTACTCTTCGTCGACGGAA...

CDS

Download CDS FASTA

552 bp · TkA04G053940|TK1151|CDS

ATGCCTTTGTATCGACACCTCCACCAGTTACATCTTAAATCCCTTCAACAGGGGTTCAGCAAATCTCTTGCCAGGACCGTGATTATAGATGGGAGAAAGCGGATTTTGCAGTCTGGATCCATTCATTATCCTCGAGCCACTCCCGAAATGTGGTCAGATATCATTGGGAAGGCAAAAGAAGGAGGATTGGATGTTATCGAGACTTATGTTTTCTGGAATTACCATGAGCCTGTTAAGAATGGTACTCTTCGTCGACGGAA...

Protein

Download Protein FASTA

183 aa · TkA04G053940|TK1151|PROTEIN

MPLYRHLHQLHLKSLQQGFSKSLARTVIIDGRKRILQSGSIHYPRATPEMWSDIIGKAKEGGLDVIETYVFWNYHEPVKNGTLRRRKRAVTSVDKIVVPVLTNANSATEGSGSREDTQPASSPLVVEGNVSNTMHSMPSQRQRRKRGPNINKKATQVLDNLKESHSAARLTFLYNWKHFCHLV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G053940`
TK1151 ID	TkA04G053940
OH-1004 ID	LXL04_007484
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.300
Protein coverage (%)	TK1151 100.000 / OH-1004 35.603 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G053940

Location Chr04:14407493-14409211 (+)

Description Similar to BGAL1: Beta-galactosidase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0533400`	Beta-galactosidase 1.	No verified direct reference in this release
`Os06g0628500`	Putative beta-galactosidase 10.	No verified direct reference in this release
`Os10g0330600`	Beta-galactosidase 13.	No verified direct reference in this release
`UniProt: A2X2H7`	Beta-galactosidase 4.	No verified direct reference in this release
`Os02g0219200`	Beta-galactosidase 4.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007484 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0019388 galactose catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004565 beta-galactosidase activity Molecular Function

GO:0030246 carbohydrate binding Molecular Function

KEGG gene cross-reference

ath:AT3G13750

dosa:Os02g0219200

dosa:Os06g0573600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.275

Rank 1 · TkA04G053940 · TK1151

Mitochondrion0.258

Rank 2 · TkA04G053940 · TK1151

Nucleus0.224

Rank 3 · TkA04G053940 · TK1151

Endoplasmic reticulum0.150

Rank 4 · TkA04G053940 · TK1151

Cell membrane0.102

Rank 5 · TkA04G053940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01301Glyco_hydro_3527-80 aa

PF01301Glyco_hydro_35117-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G053940	`PF01301`	Glyco_hydro_35	27	80	2.1e-20	74.3
TkA04G053940	`PF01301`	Glyco_hydro_35	117	159	2.1e-20	74.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RUV9`	Oryza sativa subsp. japonica	sp\|Q8RUV9\|BGAL1_ORYSJ Beta-galactosidase 1	73.600%	Swiss-Prot	Low
`Q67VU7`	Oryza sativa subsp. japonica	sp\|Q67VU7\|BGA10_ORYSJ Putative beta-galactosidase 10	75.500%	Swiss-Prot	Low
`Q7G3T8`	Oryza sativa subsp. japonica	sp\|Q7G3T8\|BGA13_ORYSJ Beta-galactosidase 13	75.500%	Swiss-Prot	Low
`A2X2H7`	Oryza sativa subsp. indica	sp\|A2X2H7\|BGAL4_ORYSI Beta-galactosidase 4	72.700%	Swiss-Prot	Low
`Q6Z6K4`	Oryza sativa subsp. japonica	sp\|Q6Z6K4\|BGAL4_ORYSJ Beta-galactosidase 4	72.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card