RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G050080
Reference: TK1151 Chr: Chr04 Coordinates: 13416348-13420628 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2687 bp · TkA04G050080|TK1151|cDNA

CGTAGCCCTAGTTCTCAGTTCTTCGTTACTCACACGAGGACAATACACCACAGCTTCATCGCCATTCGGCTATCCATCTCAAAACCCTAGAAGATGTCAGGCGGTTTCTTCCGGGGTACTACGGCCGATCAAGACACTCGTTTCTCAAACAAGCATGCTAAGCTGCTTAAATCGAAGAAGTTCCCACCTGAATTGGAAAATCTGTTTTATCGGACACATAAAAAACAGTAAGACATTAAGTGTTACAAACATGGGTCAGA...

CDS

Download CDS FASTA

978 bp · TkA04G050080|TK1151|CDS

ATGCGGGTCACAATCGTCCGCGTCTCCCCACGACAGGTGTCAGCGTCTCCTGTGCGTCCTAGATCGCCTTCACCGGTTCGCCGGAGGTCACCGTCTCCGGTAAGGCGGAGATATAATCAAAGAGGACCGTCACCTCCACGTCACCGGTCTCCTTCGCCAGGTAGGCGAAGTAGGCCAACAAACTTTTCTAGCCGCCAACGATCACCGCCTAGTTCTAGAAGAAGTATGTCCACTTCACCTTCACCAAGGCGCCCTGTACA...

Protein

Download Protein FASTA

325 aa · TkA04G050080|TK1151|PROTEIN

MRVTIVRVSPRQVSASPVRPRSPSPVRRRSPSPVRRRYNQRGPSPPRHRSPSPGRRSRPTNFSSRQRSPPSSRRSMSTSPSPRRPVQSPRDGHRGVERSVRTLGRRGSHNGNPALSSPQHSSPMGSVSPPPPARSPSEEKSPILEKRQREITNTKDNMEAEEMTFSRAKEDKHGKNKQSPEKLTTSHHRKSRNDDGRRNDNTEPVDEPPRSRKDILSRDCEKDSRAINNNNTQSGSLDSGSDERKQKRSKKKDVTSDDDD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G050080
TK1151 IDTkA04G050080
OH-1004 IDLXL04_036398
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)98.400
Protein coverage (%)TK1151 59.077 / OH-1004 26.966
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G050080
LocationChr04:13416348-13420628 (+)
DescriptionSimilar to SRRM1: Serine/arginine repetitive matrix protein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_036398 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000375 RNA splicing, via transesterification reactions Biological Process
GO:0000398 mRNA splicing, via spliceosome Biological Process
GO:0006397 mRNA processing Biological Process
GO:0008380 RNA splicing Biological Process
GO:0045292 mRNA cis splicing, via spliceosome Biological Process
GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process
GO:0005634 nucleus Cellular Component
GO:0005654 nucleoplasm Cellular Component
GO:0005681 spliceosomal complex Cellular Component
GO:0005829 cytosol Cellular Component
GO:0016363 nuclear matrix Cellular Component
GO:0016607 nuclear speck Cellular Component
KEGG gene cross-reference
gga:428216
hsa:10250
mmu:51796
pon:100173713
spo:2539459
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.973
Rank 1 · TkA04G050080 · TK1151
Cytoplasm0.107
Rank 2 · TkA04G050080 · TK1151
Cell membrane0.018
Rank 3 · TkA04G050080 · TK1151
Mitochondrion0.009
Rank 4 · TkA04G050080 · TK1151
Endoplasmic reticulum0.007
Rank 5 · TkA04G050080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser