TkA04G038640 | RubberDandelionOmics

Gene overview

TkA04G038640

Reference: TK1151 Chr: Chr04 Coordinates: 10367016-10372566 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4356 bp · TkA04G038640|TK1151|cDNA

TAATAACCTTACATAAATTAATGATACACAAAGTTGCGTAAATTTCAATATGGCTGCTTGTCAAGAAGAAGAGAAGCCATCGTCGAATCAGGTGGCAATAGTTTCTTTGAAGTAAAGTATAAAACTTTGAATGAATATCCATTGACAATGTCAACGAATTGAAGTCCACATATGCTCCAGTCACGTAAAATATTATATTATGTCGAGTGTTCTGTACAAAAGCTAGTCATATACGTTGAAATATTCTATCAGTAAATGGA...

CDS

Download CDS FASTA

1800 bp · TkA04G038640|TK1151|CDS

ATGAGAGGGCATATTGACGGTATGCCTTGTGTTGCTCATCTTCAATTGAAAATGAATAAAAAATTAACTAAGGTAAATGATCAAGGAAGTATGGAATTTGGAAAATCTCAACCCCTTCTAAAAGGAACAATTGGTGGATATCTCAACTTCAACTCCGTAGAGAAGGGAAGATTCTATGTAATTGAAGGAGAAGTTGACTTATGTGAAGTGGACATCAGAACTCCTTACACACAGTTCATGCACTATCGCCTCCTTCTTGT...

Protein

Download Protein FASTA

599 aa · TkA04G038640|TK1151|PROTEIN

MRGHIDGMPCVAHLQLKMNKKLTKVNDQGSMEFGKSQPLLKGTIGGYLNFNSVEKGRFYVIEGEVDLCEVDIRTPYTQFMHYRLLLVASSGSRYILEGKKVLNPFLIGLYGWKESTTLQVTFKKVRKNDPSEEIIDLKGVLHISTFELIRSLISMEGNNKLKFAWCLFQSIFRTYVMQIPSKNFMGSPHVEPLDRPYPISTLHEIKTGDGFVIGCRQWKIKPNDSWRCGREKYPSPVLLINGYSTDSFWLPTEENDLVRT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G038640`
TK1151 ID	TkA04G038640
OH-1004 ID	LXL04_036525
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.700
Protein coverage (%)	TK1151 100.000 / OH-1004 50.849 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G038640`
Location	Chr04:10367016-10372566 (-)
Description	Similar to choD: Cholesterol oxidase (Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036525` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006707 cholesterol catabolic process Biological Process GO:0008203 cholesterol metabolic process Biological Process GO:0005576 extracellular region Cellular Component GO:0016020 membrane Cellular Component GO:0004769 steroid Delta-isomerase activity Molecular Function GO:0016995 cholesterol oxidase activity Molecular Function GO:0046577 long-chain-alcohol oxidase activity Molecular Function GO:0050660 flavin adenine dinucleotide binding Molecular Function
KEGG gene cross-reference	mtc:MT3517 mtu:Rv3409c mtv:RVBD_3409c These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.326

Rank 1 · TkA04G038640 · TK1151

Cytoplasm0.218

Rank 2 · TkA04G038640 · TK1151

Lysosome / Vacuole0.215

Rank 3 · TkA04G038640 · TK1151

Golgi apparatus0.151

Rank 4 · TkA04G038640 · TK1151

Cell membrane0.138

Rank 5 · TkA04G038640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00561Abhydrolase_1236-325 aa

PF05057DUF676296-331 aa

PF00561Abhydrolase_1452-525 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G038640	`PF00561`	Abhydrolase_1	236	325	0.042	14.2
TkA04G038640	`PF05057`	DUF676	296	331	0.039	14.2
TkA04G038640	`PF00561`	Abhydrolase_1	452	525	0.042	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card