TkA04G032840 | RubberDandelionOmics

Gene overview

TkA04G032840

Reference: TK1151 Chr: Chr04 Coordinates: 8776161-8777621 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1106 bp · TkA04G032840|TK1151|cDNA

TTCTTTCCCTCCTGAATCTGGCCGGATCCGCGGTCTCTCTCTCCGGCGGTGGTTCTCCGGTTTCTTGTTTTATCTATAAATACAAACCACCAGTTTATTTCCTCAAAACCATCCCCTCTCTCTCTCTCCCTTCAAACTTCACAACATGTCTTCCATGACAACCTCTGTGGTTTTCTTCCTGACCACCGCCCTCCTCCACACTGCCACCACCGCCTATGGCAGCTGGCAGAGCGCCCACGCCACCTTTTATGGTGGTGGTG...

CDS

Download CDS FASTA

750 bp · TkA04G032840|TK1151|CDS

ATGTCTTCCATGACAACCTCTGTGGTTTTCTTCCTGACCACCGCCCTCCTCCACACTGCCACCACCGCCTATGGCAGCTGGCAGAGCGCCCACGCCACCTTTTATGGTGGTGGTGATGCAGCCGGCACAATGGGTGGAGCATGTGGTTATGGTGATTTATATAGCCAAGGATACGGTACAAATACTGCGGCATTGAGTACGGCACTTTTTAACAACGGATTAAGTTGTGGTGGGTGTTACGAGATGAAGTGTGTGAACGA...

Protein

Download Protein FASTA

249 aa · TkA04G032840|TK1151|PROTEIN

MSSMTTSVVFFLTTALLHTATTAYGSWQSAHATFYGGGDAAGTMGGACGYGDLYSQGYGTNTAALSTALFNNGLSCGGCYEMKCVNDPQWCLPGSVIITATNFCPPNFDLPSNNGGWCNPPLQHFDMAQPAFLHIAKYKAGIVPVSFRRVPCMKRGGIRFTMHGHSYFNLVLISNVGGAGDVHAVSIKGSKTGWQSMSRNWGQNWQSNSYLNGQSLSFRVTTSDGKTTTSYNVVRAGWQFGQTYQGDQF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G032840`
TK1151 ID	TkA04G032840
OH-1004 ID	LXL04_036641
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G032840

Location Chr04:8776161-8777621 (+)

Description Similar to EXPA4: Expansin-A4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69530`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At2g40610`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2Y5R6`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os05g0477600`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	Regulation of expansin gene expression affects growth and development in transgenic rice plants.2003 · DOI: 10.1105/tpc.011965
`Os01g0823100`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036641 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006949 syncytium formation Biological Process

GO:0009635 response to herbicide Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009828 plant-type cell wall loosening Biological Process

GO:0009831 plant-type cell wall modification involved in multidimensional cell growth Biological Process

GO:0010114 response to red light Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0071669 plant-type cell wall organization or biogenesis Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009505 plant-type cell wall Cellular Component

KEGG gene cross-reference

ath:AT1G69530

ath:AT2G40610

dosa:Os01g0823100

dosa:Os05g0477600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.651

Rank 1 · TkA04G032840 · TK1151

Cytoplasm0.121

Rank 2 · TkA04G032840 · TK1151

Lysosome / Vacuole0.113

Rank 3 · TkA04G032840 · TK1151

Endoplasmic reticulum0.072

Rank 4 · TkA04G032840 · TK1151

Cell membrane0.038

Rank 5 · TkA04G032840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29515Expansin_N31-105 aa

PF22514EXPB1_D131-153 aa

PF03330DPBB_162-147 aa

PF01357Expansin_C158-234 aa

PF29515Expansin_N218-228 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G032840	`PF29515`	Expansin_N	31	105	1.3e-08	35.8
TkA04G032840	`PF22514`	EXPB1_D1	31	153	1.1e-06	29.8
TkA04G032840	`PF03330`	DPBB_1	62	147	2.3e-22	79.8
TkA04G032840	`PF01357`	Expansin_C	158	234	1.2e-32	112.6
TkA04G032840	`PF29515`	Expansin_N	218	228	1.3e-08	35.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C554`	Arabidopsis thaliana	sp\|Q9C554\|EXPA1_ARATH Expansin-A1	77.200%	Swiss-Prot	High
`O22874`	Arabidopsis thaliana	sp\|O22874\|EXPA8_ARATH Expansin-A8	79.200%	Swiss-Prot	High
`A2Y5R6`	Oryza sativa subsp. indica	sp\|A2Y5R6\|EXPA4_ORYSI Expansin-A4	73.400%	Swiss-Prot	High
`Q0DHB7`	Oryza sativa subsp. japonica	sp\|Q0DHB7\|EXPA4_ORYSJ Expansin-A4	73.400%	Swiss-Prot	High
`Q40636`	Oryza sativa subsp. japonica	sp\|Q40636\|EXPA2_ORYSJ Expansin-A2	77.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card