TkA04G029680 | RubberDandelionOmics

Gene overview

TkA04G029680

Reference: TK1151 Chr: Chr04 Coordinates: 7839598-7842071 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1010 bp · TkA04G029680|TK1151|cDNA

CAGGGTAACATAGCCTACGGATTTTCTATAAAACCCACCAAATGGATAAACTTCATGCTGCCCGAAAGCTGAAGATTCATTTAACTAAAATCCCCTTCTACCCGTGAAACTGTGGCCTCCACCTTCTTCTTTCACTACTCCAGTCTGTGTGTGCTACTGTTTGTTTCTGCCTGATCTACTGATCTCCAATCAGTTCAAGAGAAAATGCAAGGAGGAATCAGAGCATTGGTATCACAAGGGAGCATTGTGAAAAATGCACT...

CDS

Download CDS FASTA

624 bp · TkA04G029680|TK1151|CDS

ATGCAAGGAGGAATCAGAGCATTGGTATCACAAGGGAGCATTGTGAAAAATGCACTTCTTCAACATGTTCGTGTAGTGAACATGAACACCCTTCGACCATTGATGCTGTCAAGATCTGAGTCAACTTCAGCTGCTCCTCGTATGGAAGAACACGGTTTTGAAAGCACCACCATTTCAGACATCTTGAAAGGAAAAGGAAAAGGCGCTGATGGCTCATGGCTCTGGTGTACCACTGATGATTCTGTTTATGATGCTGTCAA...

Protein

Download Protein FASTA

207 aa · TkA04G029680|TK1151|PROTEIN

MQGGIRALVSQGSIVKNALLQHVRVVNMNTLRPLMLSRSESTSAAPRMEEHGFESTTISDILKGKGKGADGSWLWCTTDDSVYDAVKSMTQHNVGALVVVKPGEQSAIAGIITERDYLRKIIVQGRSSKSTKVGDIMTEENKLITVTPDTKVLKAMQLMTDNRIRHIPVINDKEMLGMVSIGDVVRAVVSEHREELNRLNAFIQGGY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G029680`
TK1151 ID	TkA04G029680
OH-1004 ID	LXL04_031948
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	29.700
Protein coverage (%)	TK1151 48.792 / OH-1004 17.766 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G029680

Location Chr04:7839598-7842071 (+)

Description Similar to CBSCBSPB5: CBS domain-containing protein CBSCBSPB5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g10860`	CBS domain-containing protein CBSX3, mitochondrial.	No verified direct reference in this release
`At3g52950`	CBS domain-containing protein CBSCBSPB3.	No verified direct reference in this release
`At2g36500`	CBS domain-containing protein CBSCBSPB2.	No verified direct reference in this release
`At5g50530`	CBS domain-containing protein CBSCBSPB4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031948 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009536 plastid Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT2G36500

ath:AT3G52950

ath:AT5G50530

ath:AT5G50640

ath:AT5G63490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.946

Rank 1 · TkA04G029680 · TK1151

Cytoplasm0.113

Rank 2 · TkA04G029680 · TK1151

Nucleus0.080

Rank 3 · TkA04G029680 · TK1151

Cell membrane0.038

Rank 4 · TkA04G029680 · TK1151

Plastid0.018

Rank 5 · TkA04G029680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07299EF-G-binding_N7-25 aa

PF00571CBS55-62 aa

PF20836HAO_bd73-105 aa

PF00571CBS75-121 aa

PF07299EF-G-binding_N77-114 aa

PF00571CBS133-189 aa

PF07299EF-G-binding_N146-171 aa

PF20836HAO_bd179-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G029680	`PF07299`	EF-G-binding_N	7	25	0.12	13.6
TkA04G029680	`PF00571`	CBS	55	62	1.2e-23	83.9
TkA04G029680	`PF20836`	HAO_bd	73	105	0.062	14.1
TkA04G029680	`PF00571`	CBS	75	121	1.2e-23	83.9
TkA04G029680	`PF07299`	EF-G-binding_N	77	114	0.12	13.6
TkA04G029680	`PF00571`	CBS	133	189	1.2e-23	83.9
TkA04G029680	`PF07299`	EF-G-binding_N	146	171	0.12	13.6
TkA04G029680	`PF20836`	HAO_bd	179	188	0.062	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LEV3`	Arabidopsis thaliana	sp\|Q9LEV3\|CBSX3_ARATH CBS domain-containing protein CBSX3, mitochondrial	81.200%	Swiss-Prot	High
`Q9LF97`	Arabidopsis thaliana	sp\|Q9LF97\|Y3295_ARATH CBS domain-containing protein CBSCBSPB3	27.300%	Swiss-Prot	Low
`Q9SJQ5`	Arabidopsis thaliana	sp\|Q9SJQ5\|Y2650_ARATH CBS domain-containing protein CBSCBSPB2	28.700%	Swiss-Prot	Low
`Q0WLC7`	Arabidopsis thaliana	sp\|Q0WLC7\|Y5053_ARATH CBS domain-containing protein CBSCBSPB4	29.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card