TkA04G027950 | RubberDandelionOmics

Gene overview

TkA04G027950

Reference: TK1151 Chr: Chr04 Coordinates: 7368421-7377309 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA No cDNA sequence available

cDNA

No cDNA sequence is available for this reference.

CDS

Download CDS FASTA

480 bp · TkA04G027950|TK1151|CDS

ATGGCAACCGAAGCTACCAACGGAGCAGCCTCCGCGGCGCAGCCGGTGACGTTCACTGGGTTAAAACAGCATTTGTTTGTGGAGGCTTCAAAGGCGAACGACGCTGTTGCATTCTACAAAGCTGCATTCGGAGCTGAAGAGTTGAACCGCGTGAATCATCCTAAGAGGAAATCCGACGAGGAGCTCCCCCTGCTTCTCTCTGCTGAGATAAAGCTCGGTTCCTCGACGATCCTCGTTTCTGACCTCGCTGACGACTCAAC...

Protein

Download Protein FASTA

159 aa · TkA04G027950|TK1151|PROTEIN

MATEATNGAASAAQPVTFTGLKQHLFVEASKANDAVAFYKAAFGAEELNRVNHPKRKSDEELPLLLSAEIKLGSSTILVSDLADDSTDPVKSASTGLVFCLETEDIEAAVDKAVKAGAEGEVTEGEGACGGGRVGKVKDPYGIVWLICTPAKKHCDVDA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G027950`
TK1151 ID	TkA04G027950
OH-1004 ID	LXL04_019048
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	76.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G027950

Location Chr04:7368421-7377309 (-)

Description Similar to At5g48480: Uncharacterized protein At5g48480

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g48480`	Uncharacterized protein At5g48480.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019048 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT5G48480

mbo:BQ2027_MB0911C

mtc:MT0910

mtu:Rv0887c

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.723

Rank 1 · TkA04G027950 · TK1151

Nucleus0.385

Rank 2 · TkA04G027950 · TK1151

Cell membrane0.081

Rank 3 · TkA04G027950 · TK1151

Mitochondrion0.068

Rank 4 · TkA04G027950 · TK1151

Endoplasmic reticulum0.063

Rank 5 · TkA04G027950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17141DUF51144-37 aa

PF13669Glyoxalase_424-119 aa

PF22656At5g48480-like_N25-82 aa

PF00903Glyoxalase25-145 aa

PF18029Glyoxalase_625-142 aa

PF069833-dmu-9_3-mt28-147 aa

PF22677Ble-like_N35-44 aa

PF17141DUF511477-119 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G027950	`PF17141`	DUF5114	4	37	0.082	14.1
TkA04G027950	`PF13669`	Glyoxalase_4	24	119	0.0013	19.8
TkA04G027950	`PF22656`	At5g48480-like_N	25	82	1.8e-30	105.2
TkA04G027950	`PF00903`	Glyoxalase	25	145	1.4e-08	35.9
TkA04G027950	`PF18029`	Glyoxalase_6	25	142	0.00025	22.4
TkA04G027950	`PF06983`	3-dmu-9_3-mt	28	147	3.3e-05	25.1
TkA04G027950	`PF22677`	Ble-like_N	35	44	0.25	11.9
TkA04G027950	`PF17141`	DUF5114	77	119	0.082	14.1
TkA04G027950	`PF22677`	Ble-like_N	99	110	0.25	11.9
TkA04G027950	`PF22650`	At5g48480-like_C	100	146	4.9e-12	46.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV66`	Arabidopsis thaliana	sp\|Q9LV66\|Y5848_ARATH Uncharacterized protein At5g48480	48.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card