TkA04G018990 | RubberDandelionOmics

Gene overview

TkA04G018990

Reference: TK1151 Chr: Chr04 Coordinates: 4762209-4763960 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1384 bp · TkA04G018990|TK1151|cDNA

GTGGACTACACATTCAAGAAAATTGAGTAATTTCTAATTAAAAAAAAAATTCTTTTTGACCCCCCTAAAAACCTATACATCCCAATCCTAATTGTGATACAAGCAGATTGAGAAATTGATCATGGCTCTACTTGTTTCTACCTGGTCTAATGGAGCTCAATCCGTTCCTCAAGATTACATTATGCCACCGGAAAGAAGACCCGGTGATTTCGTCACAGTTTGCAAGGATATTCCGGTGATCAATCTTCAAAACGATCGGT...

CDS

Download CDS FASTA

1017 bp · TkA04G018990|TK1151|CDS

ATGGCTCTACTTGTTTCTACCTGGTCTAATGGAGCTCAATCCGTTCCTCAAGATTACATTATGCCACCGGAAAGAAGACCCGGTGATTTCGTCACAGTTTGCAAGGATATTCCGGTGATCAATCTTCAAAACGATCGGTCTGAAATCGTCCACCAAGTTTTCAAAGCTTGTCAAGAATTCGGCCTATTTCAAGTGATCAATCATGGAGTTTCGGAGGAACTGATGGCTGACATTAGGGTGTTGTACGACGAGTTCTTCAA...

Protein

Download Protein FASTA

338 aa · TkA04G018990|TK1151|PROTEIN

MALLVSTWSNGAQSVPQDYIMPPERRPGDFVTVCKDIPVINLQNDRSEIVHQVFKACQEFGLFQVINHGVSEELMADIRVLYDEFFKMPIEDKLSVYSENFGKGCSLYTSGLNYAKEDFHFWKDTLKHGCHPLEEHSPSCPEKPARYREEVGKYAVEVRKMGFKILDMIGEGLGLTEGYFVEVSQEQSMAINHYPPCPDPSLAMGIGGHTDPNLITFLQQDHYGLQIQKDGIWMGIDPIPNAFVVNLGHQLKIISNEKLK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G018990`
TK1151 ID	TkA04G018990
OH-1004 ID	LXL04_036879
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	93.600
Protein coverage (%)	TK1151 96.450 / OH-1004 37.714 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G018990

Location Chr04:4762209-4763960 (+)

Description Similar to H6H: Hyoscyamine 6-dioxygenase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24530`	Converts salicylic acid (SA) to 2,3-dihydroxybenzoic acid (2,3-DHBA) (By similarity).	Identification of arabidopsis loci required for susceptibility to the downy mildew pathogen Hyaloperonospora parasitica.2005 · DOI: 10.1094/mpmi-18-0583 Arabidopsis DMR6 encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew.2008 · DOI: 10.1111/j.1365-313x.2008.03427.x DOWNY MILDEW RESISTANT 6 and DMR6-LIKE OXYGENASE 1 are partially redundant but distinct suppressors of immunity in Arabidopsis.2015 · DOI: 10.1111/tpj.12719
`At4g10490`	Converts salicylic acid (SA) to 2,3-dihydroxybenzoic acid (2,3-DHBA) (By similarity).	DOWNY MILDEW RESISTANT 6 and DMR6-LIKE OXYGENASE 1 are partially redundant but distinct suppressors of immunity in Arabidopsis.2015 · DOI: 10.1111/tpj.12719

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0536400`	Catalyzes the 3-beta-hydroxylation of 2S-flavanones to 2R,3R- dihydroflavonols which are intermediates in the biosynthesis of flavonols, anthocyanidins, catechins and proanthocyanidins in plants.	Flavanone 3beta-hydroxylases from rice: key enzymes for favonol and anthocyanin biosynthesis.2008 · DOI: 10.1016/s1016-8478(23)17587-x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036879 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002238 response to molecule of fungal origin Biological Process

GO:0009805 coumarin biosynthetic process Biological Process

GO:0031418 L-ascorbic acid binding Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0047998 hyoscyamine (6S)-dioxygenase activity Molecular Function

KEGG gene cross-reference

ag:BAA05630

ag:BAA78340

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.835

Rank 1 · TkA04G018990 · TK1151

Nucleus0.278

Rank 2 · TkA04G018990 · TK1151

Endoplasmic reticulum0.055

Rank 3 · TkA04G018990 · TK1151

Cell membrane0.045

Rank 4 · TkA04G018990 · TK1151

Mitochondrion0.044

Rank 5 · TkA04G018990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14226DIOX_N37-137 aa

PF031712OG-FeII_Oxy186-283 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G018990	`PF14226`	DIOX_N	37	137	6.8e-21	75.8
TkA04G018990	`PF03171`	2OG-FeII_Oxy	186	283	1.1e-28	100.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLV0`	Arabidopsis thaliana	sp\|Q9FLV0\|DMR6_ARATH Protein DOWNY MILDEW RESISTANCE 6	39.200%	Swiss-Prot	Medium
`Q9ZSA7`	Arabidopsis thaliana	sp\|Q9ZSA7\|DLO2_ARATH Protein DMR6-LIKE OXYGENASE 2	39.200%	Swiss-Prot	Medium
`Q8W2X5`	Oryza sativa subsp. japonica	sp\|Q8W2X5\|FL3H2_ORYSJ Flavanone 3-dioxygenase 2	40.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card