TkA04G017750 | RubberDandelionOmics

Gene overview

TkA04G017750

Reference: TK1151 Chr: Chr04 Coordinates: 4447390-4449637 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1374 bp · TkA04G017750|TK1151|cDNA

TCCTCATATTCTTCTTCTTCTCTCTCTCTCTCTTAAATTGCACCAATTCTCTATCTCTGCATAAATTACTCCTTTTTTCGAATTAAAAACACAGAAATTATGTTCCTGGTGTGCTTATGTCGTGGGAATTCTCTGCGTGAATCAACGGAAAGTTTCTCCCTCACACATCCAGAAACCCAATATGAAGATTTAAAGAATCTTTTGTTAGGGCTCTTGTAACTTCCTGGGGAAAAAGATGTGTTTGAATTTACTATAATTGA...

CDS

Download CDS FASTA

426 bp · TkA04G017750|TK1151|CDS

ATGGAAGGAAGTGTGACGACTTTAGATGGAAGTTCGTTTCATTTGATTGGGTCTTCTCGGTCAACTGACCAAGGTACTTATCAACACAAACCGAGGTGTTCTGCTAGAGGAGATGATGGAAGCGTGAAATGTGGGAGTTCTGGTAGATGTCATTGCTCTAAAAAAAGGAAACATAGGGTTAAGAGGTCGATCAAAGTGCCAGCTGTCAGTAACAAGCTTGCAGATATACCTCCAGATGAATATTCATGGAGGAAATATGG...

Protein

Download Protein FASTA

141 aa · TkA04G017750|TK1151|PROTEIN

MEGSVTTLDGSSFHLIGSSRSTDQGTYQHKPRCSARGDDGSVKCGSSGRCHCSKKRKHRVKRSIKVPAVSNKLADIPPDEYSWRKYGQKPIKGSPHPRCSSMRGCPARKHVERCLDDSTMLIVTYEGEHNHTRLPSQSANT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G017750`
TK1151 ID	TkA04G017750
OH-1004 ID	LXL04_036911
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.200
Protein coverage (%)	TK1151 100.000 / OH-1004 36.709 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G017750

Location Chr04:4447390-4449637 (+)

Description Similar to WRKY21: Probable WRKY transcription factor 21

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30590`	Transcription factor.	No verified direct reference in this release
`At3g04670`	Transcription factor.	No verified direct reference in this release
`At5g28650`	Transcription factor.	No verified direct reference in this release
`At2g24570`	Transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036911 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009682 induced systemic resistance Biological Process

GO:0019760 glucosinolate metabolic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:2000022 regulation of jasmonic acid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT2G24570

ath:AT2G30590

ath:AT3G04670

ath:AT4G31550

ath:AT5G28650

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.909

Rank 1 · TkA04G017750 · TK1151

Cytoplasm0.176

Rank 2 · TkA04G017750 · TK1151

Cell membrane0.025

Rank 3 · TkA04G017750 · TK1151

Mitochondrion0.025

Rank 4 · TkA04G017750 · TK1151

Endoplasmic reticulum0.013

Rank 5 · TkA04G017750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106WRKY28-35 aa

PF10533Plant_zn_clust31-75 aa

PF03106WRKY43-58 aa

PF03106WRKY79-131 aa

PF10533Plant_zn_clust98-107 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G017750	`PF03106`	WRKY	28	35	7.5e-21	74.8
TkA04G017750	`PF10533`	Plant_zn_clust	31	75	1.6e-17	64.0
TkA04G017750	`PF03106`	WRKY	43	58	7.5e-21	74.8
TkA04G017750	`PF03106`	WRKY	79	131	7.5e-21	74.8
TkA04G017750	`PF10533`	Plant_zn_clust	98	107	1.6e-17	64.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04336`	Arabidopsis thaliana	sp\|O04336\|WRK21_ARATH Probable WRKY transcription factor 21	66.400%	Swiss-Prot	High
`Q9SR07`	Arabidopsis thaliana	sp\|Q9SR07\|WRK39_ARATH Probable WRKY transcription factor 39	71.400%	Swiss-Prot	High
`Q93WU6`	Arabidopsis thaliana	sp\|Q93WU6\|WRK74_ARATH Probable WRKY transcription factor 74	70.500%	Swiss-Prot	High
`Q9SJA8`	Arabidopsis thaliana	sp\|Q9SJA8\|WRK17_ARATH Probable WRKY transcription factor 17	72.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card