TkA04G012380 | RubberDandelionOmics

Gene overview

TkA04G012380

Reference: TK1151 Chr: Chr04 Coordinates: 3095545-3097836 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1339 bp · TkA04G012380|TK1151|cDNA

GAGCAGTAAGCATTAACCATCATCAATGGCCACTCTTCTTTCATCCTCTCTCCTCTTCTCCAATCTCTCTCCCCCTTCTCTCTCTCCCTCTCTCTCTCTCTCCACCACCACCACCACCACCTCTTCCTCCTCCTCCCTATCCTCCTCCGTCTCTCTCTCTCCTCTCTCTCTCTCATCTTCTTCAAGAAAAAAACATTCTCTTTCTTCTTCATTCAAAGTCAAAGCCACCATTGTCGCTTCTTCAGAGAAGAAGAAAGTGG...

CDS

Download CDS FASTA

1209 bp · TkA04G012380|TK1151|CDS

ATGGCCACTCTTCTTTCATCCTCTCTCCTCTTCTCCAATCTCTCTCCCCCTTCTCTCTCTCCCTCTCTCTCTCTCTCCACCACCACCACCACCACCTCTTCCTCCTCCTCCCTATCCTCCTCCGTCTCTCTCTCTCCTCTCTCTCTCTCATCTTCTTCAAGAAAAAAACATTCTCTTTCTTCTTCATTCAAAGTCAAAGCCACCATTGTCGCTTCTTCAGAGAAGAAGAAAGTGGCGATTGTTAACACAAACAGCGGCGG...

Protein

Download Protein FASTA

402 aa · TkA04G012380|TK1151|PROTEIN

MATLLSSSLLFSNLSPPSLSPSLSLSTTTTTTSSSSSLSSSVSLSPLSLSSSSRKKHSLSSSFKVKATIVASSEKKKVAIVNTNSGGHAVIGFYFAKQLLSSGHDVTILTVGDESSDKMKKTPFTRFSEIVDGGGKTVWGDVGAIGTVLEGLSFDVVLDNNGKDLDAVRPVADWAKSAGVGQFLFISSAGIYKQTEEPPHVEEDAVKADAGHVLVEKYLSETFENWASFRPQYMIGSGNNKDCEEWFFDRIVRGRPVPIP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G012380`
TK1151 ID	TkA04G012380
OH-1004 ID	LXL04_036978
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G012380

Location Chr04:3095545-3097836 (+)

Description Similar to CSP41A: Chloroplast stem-loop binding protein of 41 kDa a, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63140`	Binds and cleaves RNA, particularly in stem-loops.	Arabidopsis thaliana mutants reveal a role for CSP41a and CSP41b, two ribosome-associated endonucleases, in chloroplast ribosomal RNA metabolism.2008 · DOI: 10.1007/s11103-008-9328-2 The RNA-binding proteins CSP41a and CSP41b may regulate transcription and translation of chloroplast-encoded RNAs in Arabidopsis.2009 · DOI: 10.1007/s11103-008-9436-z
`At1g09340`	Binds and cleaves RNA, particularly in stem-loops.	ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings.2006 · DOI: 10.1007/s00425-006-0282-4 Arabidopsis thaliana mutants reveal a role for CSP41a and CSP41b, two ribosome-associated endonucleases, in chloroplast ribosomal RNA metabolism.2008 · DOI: 10.1007/s11103-008-9328-2 The RNA-binding proteins CSP41a and CSP41b may regulate transcription and translation of chloroplast-encoded RNAs in Arabidopsis.2009 · DOI: 10.1007/s11103-008-9436-z Identification of a novel heteroglycan-interacting protein, HIP 1.3, from Arabidopsis thaliana.2011 · DOI: 10.1016/j.jplph.2010.09.008 Plastid encoded RNA polymerase activity and expression of photosynthesis genes required for embryo and seed development in Arabidopsis.2014 · DOI: 10.3389/fpls.2014.00385

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036978 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005996 monosaccharide metabolic process Biological Process

GO:0006364 rRNA processing Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009409 response to cold Biological Process

GO:0009611 response to wounding Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0032544 plastid translation Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT1G09340

ath:AT3G63140

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.985

Rank 1 · TkA04G012380 · TK1151

Mitochondrion0.027

Rank 2 · TkA04G012380 · TK1151

Cytoplasm0.026

Rank 3 · TkA04G012380 · TK1151

Peroxisome0.020

Rank 4 · TkA04G012380 · TK1151

Nucleus0.015

Rank 5 · TkA04G012380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01937ARMT1-like_dom46-109 aa

PF01370Epimerase86-296 aa

PF13460NAD_binding_1086-233 aa

PF16363GDP_Man_Dehyd86-115 aa

PF13439Glyco_transf_486-156 aa

PF16363GDP_Man_Dehyd181-206 aa

PF13439Glyco_transf_4246-279 aa

PF16363GDP_Man_Dehyd260-368 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G012380	`PF01937`	ARMT1-like_dom	46	109	0.25	11.2
TkA04G012380	`PF01370`	Epimerase	86	296	1.4e-10	41.7
TkA04G012380	`PF13460`	NAD_binding_10	86	233	1.2e-05	26.0
TkA04G012380	`PF16363`	GDP_Man_Dehyd	86	115	0.021	15.0
TkA04G012380	`PF13439`	Glyco_transf_4	86	156	0.31	11.7
TkA04G012380	`PF16363`	GDP_Man_Dehyd	181	206	0.021	15.0
TkA04G012380	`PF13439`	Glyco_transf_4	246	279	0.31	11.7
TkA04G012380	`PF16363`	GDP_Man_Dehyd	260	368	0.021	15.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYA9`	Arabidopsis thaliana	sp\|Q9LYA9\|CP41A_ARATH Chloroplast stem-loop binding protein of 41 kDa a, chloroplastic	83.100%	Swiss-Prot	High
`Q9SA52`	Arabidopsis thaliana	sp\|Q9SA52\|CP41B_ARATH Chloroplast stem-loop binding protein of 41 kDa b, chloroplastic	37.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card