TkA04G001980 | RubberDandelionOmics

Gene overview

TkA04G001980

Reference: TK1151 Chr: Chr04 Coordinates: 503410-506407 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

828 bp · TkA04G001980|TK1151|cDNA

ATGGGTTTCAGCGGAGGAGTAGGACACCCTTCGTCAAGCGCCTCTACCAGCACTGCCAGATCCATCACCGTCGAAGCTATATTGATCGGTGATAGCAGAAAAGAAGGCGACCCGCGAATGATCAAGTCTACCAATTATCTGATCGTGACACGAGACGATCCGGGTCTGGAACTAATTCCCAAAACGTCTCTGATCTTAGCACCGAGTCGATGGGAAGCTCGAATTCGGGTTGGTTCGGCCTTTTCAAATAAACGATACAA...

CDS

Download CDS FASTA

828 bp · TkA04G001980|TK1151|CDS

ATGGGTTTCAGCGGAGGAGTAGGACACCCTTCGTCAAGCGCCTCTACCAGCACTGCCAGATCCATCACCGTCGAAGCTATATTGATCGGTGATAGCAGAAAAGAAGGCGACCCGCGAATGATCAAGTCTACCAATTATCTGATCGTGACACGAGACGATCCGGGTCTGGAACTAATTCCCAAAACGTCTCTGATCTTAGCACCGAGTCGATGGGAAGCTCGAATTCGGGTTGGTTCGGCCTTTTCAAATAAACGATACAA...

Protein

Download Protein FASTA

275 aa · TkA04G001980|TK1151|PROTEIN

MGFSGGVGHPSSSASTSTARSITVEAILIGDSRKEGDPRMIKSTNYLIVTRDDPGLELIPKTSLILAPSRWEARIRVGSAFSNKRYKIRLAVGFDVKEVRKRMITFKGQHMHSLQNLGGKTVSLDPNISIVVTEDRDGLYAIDCLDPDMHTPKQETQAQKRSSTAAASPEQKKDQTTLPTTKHQKDTKPTKTRLRKQRDHPTSTTASAESEDELQQQQTAIVTYTKTAYKPSDEVLLLNSLDSYVLQYVVELQRRLKAAG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G001980`
TK1151 ID	TkA04G001980
OH-1004 ID	LXL04_023580
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	59.600
Protein coverage (%)	TK1151 35.636 / OH-1004 39.189 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G001980

Location Chr04:503410-506407 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16010`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`At1g80900`	High-affinity magnesium transporter that mediates the influx of magnesium.	A novel family of magnesium transport genes in Arabidopsis.2001 · DOI: 10.1105/tpc.010352 Overexpression of an Arabidopsis magnesium transport gene, AtMGT1, in Nicotiana benthamiana confers Al tolerance.2006 · DOI: 10.1093/jxb/erl201

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YFN7`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`Os06g0650800`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023580 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.824

Rank 1 · TkA04G001980 · TK1151

Cytoplasm0.243

Rank 2 · TkA04G001980 · TK1151

Mitochondrion0.038

Rank 3 · TkA04G001980 · TK1151

Cell membrane0.037

Rank 4 · TkA04G001980 · TK1151

Endoplasmic reticulum0.026

Rank 5 · TkA04G001980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03522SLC12123-226 aa

PF27880Sec_Non_Glob137-227 aa

PF15763DUF4692149-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G001980	`PF03522`	SLC12	123	226	0.077	12.7
TkA04G001980	`PF27880`	Sec_Non_Glob	137	227	0.058	14.1
TkA04G001980	`PF15763`	DUF4692	149	229	0.9	10.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S9N4`	Arabidopsis thaliana	sp\|Q9S9N4\|MRS21_ARATH Magnesium transporter MRS2-1	70.300%	Swiss-Prot	Low
`Q9SAH0`	Arabidopsis thaliana	sp\|Q9SAH0\|MRS2A_ARATH Magnesium transporter MRS2-10	67.600%	Swiss-Prot	Low
`A2YFN7`	Oryza sativa subsp. indica	sp\|A2YFN7\|MRS2B_ORYSI Magnesium transporter MRS2-B	66.700%	Swiss-Prot	Low
`Q67UQ7`	Oryza sativa subsp. japonica	sp\|Q67UQ7\|MRS2B_ORYSJ Magnesium transporter MRS2-B	66.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card