TkA03G609910 | RubberDandelionOmics

Gene overview

TkA03G609910

Reference: TK1151 Chr: Chr03 Coordinates: 154890688-154893690 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2975 bp · TkA03G609910|TK1151|cDNA

TTGTAATCTTTGTGAGTTAATAAGAATTCTCTAGTTGCAGCCCGTGGATGTAGGATTTATACTGAATCCGAACCACGTAAAATCCTTGTGTTCTTCTTGCTTTATTTTCGTGAGTTTGTGTGTGTGTGATAGTGTTTCCGCTGCGTGTACCCGGTCTCGATTCCTAACAATTGGTATCAGAGCAAGGTTGAAGGAGGTCGTATCTTGTATTATGCTCTGTGGTTGCGGCTTAGTCTGATCTGCCACATCAGAAACAAGGT...

CDS

Download CDS FASTA

1533 bp · TkA03G609910|TK1151|CDS

ATGCAATTAGAAGCATTGCTATGTCAGAAAGACTTGGATATGGTACTCGGAGACAAACCAGAGAAAATGGAAAAAACTACTGAAGATGTGTGGAACTCAAAGGACAAGAAAGCCAAGGCGGTTATTACATTGTCGTTGACGAAGAGCGTTGCTTTCAACATCATGAATGAAACCACGGCGCGTGGTATGATGGAGACTCTGTCAAATATGTATGAGAAACCATCGGCGGCTAATAAGGTGTTCTTGATGAGGGAGTTGTT...

Protein

Download Protein FASTA

510 aa · TkA03G609910|TK1151|PROTEIN

MQLEALLCQKDLDMVLGDKPEKMEKTTEDVWNSKDKKAKAVITLSLTKSVAFNIMNETTARGMMETLSNMYEKPSAANKVFLMRELFTTRMNEEGSVTVHINNLNSILSRLSSVGIKFDNETQTSLLLASLPDSWSGTVTAVTSSVGTSAMTFEGVRDLVLGEDIRRKNQGGSSSSDLLNVRRGRGNSRNSGSSGSRGKSSSRTLKNVKCWNCQEVGHVKSQCPKKELNIAGAESVSEDDALILSMESSVDSWVMDSGAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G609910`
TK1151 ID	TkA03G609910
OH-1004 ID	LXL04_010033
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	78.900
Protein coverage (%)	TK1151 93.922 / OH-1004 41.200 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G609910`
Location	Chr03:154890688-154893690 (-)
Description	Similar to DEK1: Calpain-type cysteine protease DEK1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_010033` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0001558 regulation of cell growth Biological Process GO:0001708 cell fate specification Biological Process GO:0009793 embryo development ending in seed dormancy Biological Process GO:0009934 regulation of meristem structural organization Biological Process GO:0032877 positive regulation of DNA endoreduplication Biological Process GO:0040014 regulation of multicellular organism growth Biological Process GO:0042127 regulation of cell population proliferation Biological Process GO:0090392 sepal giant cell differentiation Biological Process GO:0090628 plant epidermal cell fate specification Biological Process GO:0097264 self proteolysis Biological Process GO:2000011 regulation of adaxial/abaxial pattern formation Biological Process GO:2000014 regulation of endosperm development Biological Process
KEGG gene cross-reference	ath:AT1G55350 dosa:Os02g0709400 osa:4330484 zma:542509 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.464

Rank 1 · TkA03G609910 · TK1151

Nucleus0.364

Rank 2 · TkA03G609910 · TK1151

Cell membrane0.104

Rank 3 · TkA03G609910 · TK1151

Endoplasmic reticulum0.078

Rank 4 · TkA03G609910 · TK1151

Plastid0.068

Rank 5 · TkA03G609910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14223Retrotran_gag_24-171 aa

PF29482CG4951_C25-83 aa

PF22936Pol_BBD79-103 aa

PF22936Pol_BBD201-225 aa

PF30379SLU7_N205-223 aa

PF16588zf-C2H2_10207-226 aa

PF15288zf-CCHC_6208-229 aa

PF00098zf-CCHC209-225 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G609910	`PF14223`	Retrotran_gag_2	4	171	1.1e-33	117.1
TkA03G609910	`PF29482`	CG4951_C	25	83	0.24	12.4
TkA03G609910	`PF22936`	Pol_BBD	79	103	6.4e-21	75.2
TkA03G609910	`PF22936`	Pol_BBD	201	225	6.4e-21	75.2
TkA03G609910	`PF30379`	SLU7_N	205	223	0.22	11.8
TkA03G609910	`PF16588`	zf-C2H2_10	207	226	0.1	13.1
TkA03G609910	`PF15288`	zf-CCHC_6	208	229	0.0067	17.0
TkA03G609910	`PF00098`	zf-CCHC	209	225	1e-05	26.1
TkA03G609910	`PF22936`	Pol_BBD	253	332	6.4e-21	75.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card