RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G609660
Reference: TK1151 Chr: Chr03 Coordinates: 154820455-154835295 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2925 bp · TkA03G609660|TK1151|cDNA

TTAATACTCAACAGTCAACACAGCCTTCGCTCTCACTCCCTAAAGCTCACTACTACAACGCTCAGTTCAAATCGTTGACGATGAGGCTGGCGCCGAGGGAGGTGGAGAAATTGATGTTACATAATGCTGGATATTTAGCGCAGAAGCGTCTTGCTCGTGGATTAAGGCTTAATCACACTGAAGCTGTCGCACTTATTGCCACTCAGAACAGAGAACAGGGTAGTGATCGATAACTTGAATACAGAAATTGGATCATATAT...

CDS

Download CDS FASTA

2514 bp · TkA03G609660|TK1151|CDS

ATGAGGCTGGCGCCGAGGGAGGTGGAGAAATTGATGTTACATAATGCTGGATATTTAGCGCAGAAGCGTCTTGCTCGTGGATTAAGGCTTAATCACACTGAAGCTGTCGCACTTATTGCCACTCAGATATTGGAGTTTGTACATGATGGTGACAAGAGTGTGGCAGAATTAATGGATCTTGGGAGACAGCTTTTAGGAAGGAGACAAGTTCTTCCAACAGTTCCACACCTTTTGGATTCTGTTCAGGTTGAGGGAACCTT...

Protein

Download Protein FASTA

837 aa · TkA03G609660|TK1151|PROTEIN

MRLAPREVEKLMLHNAGYLAQKRLARGLRLNHTEAVALIATQILEFVHDGDKSVAELMDLGRQLLGRRQVLPTVPHLLDSVQVEGTFSDGTKLITVHDPLSCENGNLELALHGSFLPVPSLEKFPIIETCKIPGELISRHGYLLLNSGREAVVLKVTNNGDRPIQVGSHYHFIEVNPCLIFDRRKSYGMRLNIPAGTATRFEPGDEKSVTLVKIGGMQVIRGGNAIADTHANDSNVKTVMESVHTRGFGNSEDTSNNNGI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G609660
TK1151 IDTkA03G609660
OH-1004 IDLXL04_011666
Relationship / confidenceSequence Supported Annotation Or Model Conflict / Review
Protein identity (%)99.400
Protein coverage (%)TK1151 100.000 / OH-1004 54.421
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G609660
LocationChr03:154820455-154835295 (-)
DescriptionSimilar to URE: Urease
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g67550 Urea hydrolase involved in nitrogen recycling from ureide, purine, and arginine catabolism. No verified direct reference in this release
At1g27900 May be involved in pre-mRNA splicing. No verified direct reference in this release
At3g26560 May be involved in pre-mRNA splicing. No verified direct reference in this release
At1g32490 Involved in pre-mRNA splicing. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os12g0234800 Urea hydrolase involved in nitrogen recycling from ureide, purine, and arginine catabolism. No verified direct reference in this release
UniProt: E0ZS48 Urea hydrolase involved in nitrogen recycling from ureide, purine, and arginine catabolism. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_011666 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0043419 urea catabolic process Biological Process
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0035550 urease complex Cellular Component
GO:0009039 urease activity Molecular Function
GO:0016151 nickel cation binding Molecular Function
GO:0090729 toxin activity Molecular Function
KEGG gene cross-reference
ath:AT1G67550
gmx:547672
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.422
Rank 1 · TkA03G609660 · TK1151
Nucleus0.203
Rank 2 · TkA03G609660 · TK1151
Extracellular0.149
Rank 3 · TkA03G609660 · TK1151
Plastid0.129
Rank 4 · TkA03G609660 · TK1151
Cell membrane0.083
Rank 5 · TkA03G609660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00547Urease_gamma1-100 aa
PF00699Urease_beta133-228 aa
PF00547Urease_gamma182-198 aa
PF00449Urease_alpha212-241 aa
PF18473Urease_linker232-260 aa
PF00449Urease_alpha270-389 aa
PF07969Amidohydro_3314-332 aa
PF07969Amidohydro_3387-422 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G609660PF00547Urease_gamma11006.8e-42142.6
TkA03G609660PF00699Urease_beta1332282.5e-40137.1
TkA03G609660PF00547Urease_gamma1821986.8e-42142.6
TkA03G609660PF00449Urease_alpha2122413.7e-57192.6
TkA03G609660PF18473Urease_linker2322609.6e-0935.7
TkA03G609660PF00449Urease_alpha2703893.7e-57192.6
TkA03G609660PF07969Amidohydro_33143321.7e-0938.4
TkA03G609660PF07969Amidohydro_33874221.7e-0938.4
TkA03G609660PF01979Amidohydro_13957204.2e-81273.6
TkA03G609660PF07969Amidohydro_36517221.7e-0938.4
TkA03G609660PF00547Urease_gamma7597726.8e-42142.6
TkA03G609660PF00699Urease_beta8148282.5e-40137.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SR52Arabidopsis thalianasp|Q9SR52|UREA_ARATH Urease76.700%Swiss-ProtHigh
Q93Y16Arabidopsis thalianasp|Q93Y16|DEAH4_ARATH Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH474.500%Swiss-ProtHigh
Q38953Arabidopsis thalianasp|Q38953|DEAH5_ARATH Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH545.600%Swiss-ProtMedium
Q8VY00Arabidopsis thalianasp|Q8VY00|ESP3_ARATH Pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH147.400%Swiss-ProtMedium
B9GCH9Oryza sativa subsp. japonicasp|B9GCH9|UREA_ORYSJ Urease76.400%Swiss-ProtHigh
E0ZS48Oryza sativa subsp. indicasp|E0ZS48|UREA_ORYSI Urease76.400%Swiss-ProtHigh

JBrowse

View in Genome Browser