TkA03G602450 | RubberDandelionOmics

Gene overview

TkA03G602450

Reference: TK1151 Chr: Chr03 Coordinates: 153016714-153026110 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4719 bp · TkA03G602450|TK1151|cDNA

TCGGATCCGGGTAGTTCATCTGTACCCGGAAACAGTGCCCATACAGTAGCGTTGGAGTTCGATTTGAACGAAACCCCACTCCCTTCTTCCGGAGAAGAAGCTGCGGGTGGTAATGGCGACGGGTCTACGGCGGATCACCGGTGTTGCTCATGTTGTGAGGCGAAAGGGAAGGTGGTGGTATGCTGTGAGTGTGCAAAACATTTTCAAGTAGAGTGTTTTAGGGGGAGACTAGGAGGGAGGGAGAGGACGTGTTCCGAGTG...

CDS

Download CDS FASTA

5301 bp · TkA03G602450|TK1151|CDS

TCGGATCCGGGTAGTTCATCTGTACCCGGAAACAGTGCCCATACAGTAGCGTTGGAGTTCGATTTGAACGAAACCCCACTCCCTTCTTCCGGAGAAGAAGCTGCGGGTGGTAATGGCGACGGGTCTACGGCGGATCACCGGTGTTGCTCATGTTGTGAGGCGAAAGGGAAGGTGGTGGTATGCTGTGAGTGTGCAAAACATTTTCAAGTAGAGTGTTTTAGGGGGAGACTAGGAGGGAGGGAGAGGACGTGTTCCGAGTG...

Protein

Download Protein FASTA

1766 aa · TkA03G602450|TK1151|PROTEIN

SDPGSSSVPGNSAHTVALEFDLNETPLPSSGEEAAGGNGDGSTADHRCCSCCEAKGKVVVCCECAKHFQVECFRGRLGGRERTCSECLMECSSGKRLRRTVSATSGGDLGLMDMNVSPPREVEGDDVGVWVNSESAFTNSAPKMQDTYCNNLFTEFTLTSCNNTSTHHPQHVTNGFPSTTIETNDNSLISLQNGSQSHAIKTMEPTSKSLKVSNGGNAVKVDSMENGNHGFPVQFEDFFVISVGKVNPRRSFHTSHQIWP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G602450`
TK1151 ID	TkA03G602450
OH-1004 ID	LXL04_011568
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 99.832 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G602450

Location Chr03:153016714-153026110 (+)

Description Similar to MBD9: Methyl-CpG-binding domain-containing protein 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01460`	Probable transcriptional regulator that acts as a histone acetyltransferase.	AtMBD9: a protein with a methyl-CpG-binding domain regulates flowering time and shoot branching in Arabidopsis.2006 · DOI: 10.1111/j.1365-313x.2006.02691.x AtMBD9 modulates Arabidopsis development through the dual epigenetic pathways of DNA methylation and histone acetylation.2009 · DOI: 10.1111/j.1365-313x.2009.03860.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011568 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006397 mRNA processing Biological Process

GO:0010223 secondary shoot formation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0048573 photoperiodism, flowering Biological Process

GO:0000812 Swr1 complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT3G01460

hsa:57661

mmu:101471

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.928

Rank 1 · TkA03G602450 · TK1151

Cytoplasm0.107

Rank 2 · TkA03G602450 · TK1151

Cell membrane0.045

Rank 3 · TkA03G602450 · TK1151

Endoplasmic reticulum0.020

Rank 4 · TkA03G602450 · TK1151

Plastid0.016

Rank 5 · TkA03G602450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00628PHD49-78 aa

PF23004PHDvar_NSD49-74 aa

PF05964FYRN231-265 aa

PF05965FYRC352-384 aa

PF05965FYRC445-472 aa

PF00439Bromodomain874-943 aa

PF00628PHD1000-1044 aa

PF23004PHDvar_NSD1000-1042 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G602450	`PF00628`	PHD	49	78	4.4e-11	43.3
TkA03G602450	`PF23004`	PHDvar_NSD	49	74	0.0055	17.4
TkA03G602450	`PF05964`	FYRN	231	265	1.8e-06	28.2
TkA03G602450	`PF05965`	FYRC	352	384	0.012	16.5
TkA03G602450	`PF05965`	FYRC	445	472	0.012	16.5
TkA03G602450	`PF00439`	Bromodomain	874	943	0.00057	20.5
TkA03G602450	`PF00628`	PHD	1000	1044	4.4e-11	43.3
TkA03G602450	`PF23004`	PHDvar_NSD	1000	1042	0.0055	17.4
TkA03G602450	`PF15612`	WHIM1	1081	1123	2.8e-08	33.9
TkA03G602450	`PF15613`	WSD	1132	1208	7.3e-09	36.4
TkA03G602450	`PF00628`	PHD	1168	1177	4.4e-11	43.3
TkA03G602450	`PF31066`	DUF8799	1314	1379	2.2e-06	28.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SGH2`	Arabidopsis thaliana	sp\|Q9SGH2\|MBD9_ARATH Methyl-CpG-binding domain-containing protein 9	37.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card