TkA03G601260 | RubberDandelionOmics

Gene overview

TkA03G601260

Reference: TK1151 Chr: Chr03 Coordinates: 152679259-152684517 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

887 bp · TkA03G601260|TK1151|cDNA

TTCAATCTTCCTTTACAAGTTGGTACGGGCAACCGGGCAGGGCAGATTGTCATCACCATCGAATCATCGATCACTTCTTCCCGCGCCTTTCAGCAGCACCTCCACCGCTCCGCCTGACACAGAAAAAACACGAAGATGACGCTATCAGAAGAAGAAATCAAGCGATTGTTTCGGATCCGTAAAACTCTTATGCAAATGCTGAGAGACAGAGGTTATCTGGTTGGAGAGTTTGAAATCAACATCCGATTAAACGATTTCTT...

CDS

Download CDS FASTA

621 bp · TkA03G601260|TK1151|CDS

ATGACGCTATCAGAAGAAGAAATCAAGCGATTGTTTCGGATCCGTAAAACTCTTATGCAAATGCTGAGAGACAGAGGTTATCTGGTTGGAGAGTTTGAAATCAACATCCGATTAAACGATTTCTTGGGGAAATATGGCGAAAACATGAAACGAGAAGATCTCATAATCAGTAAATCCAAGGCCAATGATTCCTCCGATCAGATCTATGTATTTTTCCCCGAGGAACCAAAAGTTGGTGTTAAGACCTTGAAAACTTACAT...

Protein

Download Protein FASTA

206 aa · TkA03G601260|TK1151|PROTEIN

MTLSEEEIKRLFRIRKTLMQMLRDRGYLVGEFEINIRLNDFLGKYGENMKREDLIISKSKANDSSDQIYVFFPEEPKVGVKTLKTYIERMKSENVFRAILVVRENLTPIARTALSETATSFQLEVFQEPELLVNVKGHVLVPEHQVLTDEEKKTLLARYTVKETQLPRIQVTDPIARYYGLKRGQVMKIIRPSETAGRYVTYRYVV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G601260`
TK1151 ID	TkA03G601260
OH-1004 ID	LXL04_000311
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	37.500
Protein coverage (%)	TK1151 96.602 / OH-1004 84.979 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G601260

Location Chr03:152679259-152684517 (-)

Description Similar to NRPE5A: DNA-directed RNA polymerase V subunit 5A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g22320`	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000311 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006362 transcription elongation by RNA polymerase I Biological Process

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0042797 tRNA transcription by RNA polymerase III Biological Process

GO:0000418 RNA polymerase IV complex Cellular Component

GO:0000419 RNA polymerase V complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005665 RNA polymerase II, core complex Cellular Component

GO:0005666 RNA polymerase III complex Cellular Component

GO:0005736 RNA polymerase I complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003899 DNA-directed RNA polymerase activity Molecular Function

KEGG gene cross-reference

ath:AT2G41340

ath:AT3G22320

ath:AT3G54490

ath:AT3G57080

cbr:CBG_12745

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.816

Rank 1 · TkA03G601260 · TK1151

Cytoplasm0.242

Rank 2 · TkA03G601260 · TK1151

Mitochondrion0.032

Rank 3 · TkA03G601260 · TK1151

Cell membrane0.020

Rank 4 · TkA03G601260 · TK1151

Endoplasmic reticulum0.015

Rank 5 · TkA03G601260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01191RNA_pol_Rpb5_C3-16 aa

PF03871RNA_pol_Rpb5_N5-90 aa

PF22722NA-iREase153-131 aa

PF01191RNA_pol_Rpb5_C133-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G601260	`PF01191`	RNA_pol_Rpb5_C	3	16	1.5e-35	121.5
TkA03G601260	`PF03871`	RNA_pol_Rpb5_N	5	90	1.1e-31	110.0
TkA03G601260	`PF22722`	NA-iREase1	53	131	0.048	14.4
TkA03G601260	`PF01191`	RNA_pol_Rpb5_C	133	205	1.5e-35	121.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81098`	Arabidopsis thaliana	sp\|O81098\|RPB5A_ARATH DNA-directed RNA polymerases II and IV subunit 5A	74.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card