Gene Card
Gene overview
cDNA / CDS / Protein Sequences
4239 bp · TkA03G509400|TK1151|cDNA
CCAAATATGTAATCGAATGCTTCACCGCCAAAATAAAATAAAGGAAAAGCAAAGAAAAACCGCAAAAGTCACGCGTTGATTCCAAATCTTTAACCTTCAACGAAGGGAAAAAGTCGCACATACATACCTCACCCAGAAACTCCAAAGAACTTTCTTGCTGATTTCACAAAAAACCCCCTCCACATACGTACATATCGACATGGTTTTTGATTGATCGCTAGAATTAGGGCAAATCGAGGGCGAATTCGAGGCTATTTGGA...
2043 bp · TkA03G509400|TK1151|CDS
ATGATGATGACAAACGGTGATACCTCCTACCAATGGCTTGATGATGATGATGATGCAGATTTAGTTGGGGATGATGGTGCGCTGAGCATGGACATTGAATCGTTTTTAAGTATTCTTGACGAGAGTCCTCCCGATGAGCCTTTGCAGAGTGGATTGGTGGATCCTTCCTTAAGTATTGCACTCTCTAATGAGCCAGCTTCAAATGTTGCTGCAAACGACCAATCCCAAATCCATGATGATCACTCAGATGCTTCAGCTTC...
Protein
Download Protein FASTA680 aa · TkA03G509400|TK1151|PROTEIN
MMMTNGDTSYQWLDDDDDADLVGDDGALSMDIESFLSILDESPPDEPLQSGLVDPSLSIALSNEPASNVAANDQSQIHDDHSDASASKTVCSDGSSDYERQTVNYGLTKMGPVSAVSSMHNSWSPANWTVPIPPGDFSSSSHYNNRETNPERATKDGTFVNTYDNHNGSHQSMDTSSIPNFADFCSTSEAPFMNVGGYSSDFHCNPDDESSMPLPYAINRNDTSMIYNNGMMFNDKIASNGYQNSGIPQYISSKGNTFFL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G509400 |
|---|---|
| TK1151 ID | TkA03G509400 |
| OH-1004 ID | LXL04_010186 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 95.700 |
| Protein coverage (%) | TK1151 92.941 / OH-1004 53.469Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G509400 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:127745801-127751925 (+) | |||||||||
| Description | Similar to CHR28: Helicase-like transcription factor CHR28 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006281 DNA repair Biological Process GO:0006325 chromatin organization Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0009294 DNA-mediated transformation Biological Process GO:0032435 negative regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0036297 interstrand cross-link repair Biological Process GO:0045003 double-strand break repair via synthesis-dependent strand annealing Biological Process GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process GO:0000785 chromatin Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G50410 ath:AT3G20010 ath:AT5G22750 ath:AT5G43530 spo:2540464 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00176SNF2-rel_dom447-609 aaPF17158MASE4613-672 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G509400 | PF00176 | SNF2-rel_dom | 447 | 609 | 3.2e-22 | 79.7 |
| TkA03G509400 | PF17158 | MASE4 | 613 | 672 | 0.39 | 10.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.