TkA03G507700 | RubberDandelionOmics

Gene overview

TkA03G507700

Reference: TK1151 Chr: Chr03 Coordinates: 127241363-127244748 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

442 bp · TkA03G507700|TK1151|cDNA

GTTATCGGACACTCGGACATCCAAAACACCCAAAGGCAGACTTCACCGAAATCTACGACAGCCCAACCCCAGGCATCTTTTCTCTGGAGACAAATGGCGAGCTCTCTCCGTCGCATCGGAAGCCAATCTAGCACCGCTCATCGGTTTGTTGTTCCTCAGTTAATCAGTCGATTCTCTACAGATGCCTTATCTGTTGAGTATAAAGCTGGAGAGATCGGCACTGTTTCGGGTATTCCGGATGAACATCTTCAAAGGAGGGT...

CDS

Download CDS FASTA

474 bp · TkA03G507700|TK1151|CDS

ATGGCGAGCTCTCTCCGTCGCATCGGAAGCCAATCTAGCACCGCTCATCGGTTTGTTGTTCCTCAGTTAATCAGTCGATTCTCTACAGATGCCTTATCTGTTGAGTATAAAGCTGGAGAGATCGGCACTGTTTCGGGTATTCCGGATGAACATCTTCAAAGGAGGGTTCTGATCTATTCACCAGCTCGAACAGCATCACAGCAAGGAGCAGGAAAAGTTGGAAAGTGGAAAATCAATTTTATGTCAACACAGAAATGGGA...

Protein

Download Protein FASTA

157 aa · TkA03G507700|TK1151|PROTEIN

MASSLRRIGSQSSTAHRFVVPQLISRFSTDALSVEYKAGEIGTVSGIPDEHLQRRVLIYSPARTASQQGAGKVGKWKINFMSTQKWENPLMGWTSTGDPYANVGDSALTFKTEADAKSFAERHGWNYTVKKHQTPLMKAKAYSDNFKWKGPPKTAEN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G507700`
TK1151 ID	TkA03G507700
OH-1004 ID	LXL04_010151
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G507700

Location Chr03:127241363-127244748 (+)

Description Similar to FRO1: NADH dehydrogenase [ubiquinone] iron-sulfur protein 4, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67590`	Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010151 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001932 regulation of protein phosphorylation Biological Process

GO:0006120 mitochondrial electron transport, NADH to ubiquinone Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009060 aerobic respiration Biological Process

GO:0009631 cold acclimation Biological Process

GO:0022904 respiratory electron transport chain Biological Process

GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process

GO:0042776 proton motive force-driven mitochondrial ATP synthesis Biological Process

GO:0051591 response to cAMP Biological Process

GO:0072593 reactive oxygen species metabolic process Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT5G67590

ggo:101125075

hsa:4724

pon:100172316

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.943

Rank 1 · TkA03G507700 · TK1151

Cytoplasm0.048

Rank 2 · TkA03G507700 · TK1151

Nucleus0.046

Rank 3 · TkA03G507700 · TK1151

Plastid0.022

Rank 4 · TkA03G507700 · TK1151

Cell membrane0.016

Rank 5 · TkA03G507700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04800NDUS456-149 aa

PF05573NosL101-124 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G507700	`PF04800`	NDUS4	56	149	5.4e-31	107.4
TkA03G507700	`PF05573`	NosL	101	124	0.11	13.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJW4`	Arabidopsis thaliana	sp\|Q9FJW4\|NDUS4_ARATH NADH dehydrogenase [ubiquinone] iron-sulfur protein 4, mitochondrial	75.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card