TkA03G491990 | RubberDandelionOmics

Gene overview

TkA03G491990

Reference: TK1151 Chr: Chr03 Coordinates: 123360361-123370583 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1809 bp · TkA03G491990|TK1151|cDNA

AAATTAAAGCCCTCGAATGATTCTGAGTTTAAATTTAGTCATGCTCAAGAATCCGGTCAACATGTTGAAAACTCTAGCCATTCTACTATTCTTGTCAACCCTTTTCTCTGGTCCGGTATATTCTACATCAGTGGATGGGCTTTTTAGGATCAAACTAAAGAAAGTGAAACAGAGTGAAACCAATTTTGAAGTCGATTTAACGCCAACTTATAGGAAGTATACACAGAGAGTTAATAGCCTTGATGATGATTCCCAAGAAT...

CDS

Download CDS FASTA

1629 bp · TkA03G491990|TK1151|CDS

ATGATTCTGAGTTTAAATTTAGTCATGCTCAAGAATCCGGTCAACATGTTGAAAACTCTAGCCATTCTACTATTCTTGTCAACCCTTTTCTCTGGTCCGGTATATTCTACATCAGTGGATGGGCTTTTTAGGATCAAACTAAAGAAAGTGAAACAGAGTGAAACCAATTTTGAAGTCGATTTAACGCCAACTTATAGGAAGTATACACAGAGAGTTAATAGCCTTGATGATGATTCCCAAGAATCTGATATCGTACCACT...

Protein

Download Protein FASTA

542 aa · TkA03G491990|TK1151|PROTEIN

MILSLNLVMLKNPVNMLKTLAILLFLSTLFSGPVYSTSVDGLFRIKLKKVKQSETNFEVDLTPTYRKYTQRVNSLDDDSQESDIVPLNNYMNAQYFGEVGIGTPPQKFNVIFDTGSANLWVPSSECLLTAACSNHAQYEARQSSSYKPIGKSVTIQYGTDSISGNFSEDTVRVGDLIVEHQIFTEATNEDGVTFLAGKFDGILGLGFKELSIGNVSPLWDNMVNQNQVKDDIFSFWLNQNSENGEGGEIVFGGVDPNHYK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G491990`
TK1151 ID	TkA03G491990
OH-1004 ID	LXL04_010035
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	81.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G491990

Location Chr03:123360361-123370583 (+)

Description Similar to APA1: Aspartic proteinase A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11910`	Involved in the breakdown of propeptides of storage proteins in protein-storage vacuoles (By similarity).	No verified direct reference in this release
`At1g62290`	Involved in the breakdown of propeptides of storage proteins in protein-storage vacuoles.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0567100`	Involved in the breakdown of propeptides of storage proteins in protein-storage vacuoles.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010035 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0004175 endopeptidase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G11910

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.491

Rank 1 · TkA03G491990 · TK1151

Extracellular0.295

Rank 2 · TkA03G491990 · TK1151

Cytoplasm0.176

Rank 3 · TkA03G491990 · TK1151

Endoplasmic reticulum0.120

Rank 4 · TkA03G491990 · TK1151

Cell membrane0.098

Rank 5 · TkA03G491990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00026Asp94-540 aa

PF14543TAXi_N95-149 aa

PF14543TAXi_N153-253 aa

PF14541TAXi_C467-539 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G491990	`PF00026`	Asp	94	540	2.4e-109	366.3
TkA03G491990	`PF14543`	TAXi_N	95	149	1.5e-14	55.3
TkA03G491990	`PF14543`	TAXi_N	153	253	1.5e-14	55.3
TkA03G491990	`PF14541`	TAXi_C	467	539	0.17	12.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65390`	Arabidopsis thaliana	sp\|O65390\|APA1_ARATH Aspartic proteinase A1	46.800%	Swiss-Prot	Medium
`Q8VYL3`	Arabidopsis thaliana	sp\|Q8VYL3\|APA2_ARATH Aspartic proteinase A2	45.700%	Swiss-Prot	Medium
`Q42456`	Oryza sativa subsp. japonica	sp\|Q42456\|ASPR1_ORYSJ Aspartic proteinase oryzasin-1	46.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card