TkA03G486300 | RubberDandelionOmics

Gene overview

TkA03G486300

Reference: TK1151 Chr: Chr03 Coordinates: 121716470-121719567 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2057 bp · TkA03G486300|TK1151|cDNA

AGAGGGAAATGAGGCTGAGTTGCCGGCGTGGCCGGCTTTCATGGTTTTGTTCCTTTCATGGCGTTTGCTTCAAACGATGGGAAAAAACTCTCATCTCTCTTCCTTAAAAAAACGGACTCTTTTTTTTCTAAACCCCAACTCCAAAACTCTCAACATTATAAATCTTTCTTGCCTTTCCAGTTTTTTTTAAAAGAAAAGCAAAAATGGTGGGATTCGATGAGTTTTGTCAAGAAGGTCTTCTTCTTGCTCAACCTGATCCT...

CDS

Download CDS FASTA

1677 bp · TkA03G486300|TK1151|CDS

ATGGTGGGATTCGATGAGTTTTGTCAAGAAGGTCTTCTTCTTGCTCAACCTGATCCTGTTGTCTTGGAGCTTAACAAACTTCAGAACATGCTCAAAGAAAAGGACCGAGAATTGGGGTTTGCTCAAAGTGAAATAAAAGCCTTGAAAGCTGCTGATGTCATGAAGGACAAATCCCTTGAAGAGTTGGGACATATTGTAGAAAAACTCGACAATAAGATCAGATACACAGAAAACCTTCTCGAGCAAAAGAATTTGGATAT...

Protein

Download Protein FASTA

558 aa · TkA03G486300|TK1151|PROTEIN

MVGFDEFCQEGLLLAQPDPVVLELNKLQNMLKEKDRELGFAQSEIKALKAADVMKDKSLEELGHIVEKLDNKIRYTENLLEQKNLDIKKLETEKKEAFAAQFAAEATLRRVYANQKDDNSVPIESIIAPLEADIRLYKHEIAVLQEDKKMLERRTKSKEAALLEAERILRSALERALIVETVQNQNIDLRRQIEIFQEENKILEKTNRQKVLEVEKLSETIKELEEAVLAGGDTANVIRDFKRQISELQEAKRILERELA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G486300`
TK1151 ID	TkA03G486300
OH-1004 ID	LXL04_009970
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G486300

Location Chr03:121716470-121719567 (-)

Description Similar to MAP70.5: Microtubule-associated protein 70-5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17220`	Plant-specific protein that interact with microtubules and regulates microtubule dynamics.	No verified direct reference in this release
`At1g14840`	Plant-specific protein that interact with microtubules.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0640900`	Plant-specific protein that interact with microtubules.	No verified direct reference in this release
`Os03g0215700`	Plant-specific protein that interact with microtubules.	No verified direct reference in this release
`Os02g0736100`	Plant-specific protein that interact with microtubules.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009970 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007010 cytoskeleton organization Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0071555 cell wall organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005819 spindle Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0010005 cortical microtubule, transverse to long axis Cellular Component

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT1G14840

ath:AT1G24764

ath:AT1G68060

ath:AT4G17220

dosa:Os02g0736100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.711

Rank 1 · TkA03G486300 · TK1151

Nucleus0.223

Rank 2 · TkA03G486300 · TK1151

Cell membrane0.102

Rank 3 · TkA03G486300 · TK1151

Golgi apparatus0.059

Rank 4 · TkA03G486300 · TK1151

Mitochondrion0.038

Rank 5 · TkA03G486300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07058MAP7013-551 aa

PF15619Lebercilin25-93 aa

PF19260DUF590345-79 aa

PF15619Lebercilin118-166 aa

PF15619Lebercilin173-331 aa

PF19260DUF5903175-218 aa

PF15619Lebercilin378-390 aa

PF15619Lebercilin504-546 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G486300	`PF07058`	MAP70	13	551	7.7e-196	652.9
TkA03G486300	`PF15619`	Lebercilin	25	93	0.49	10.6
TkA03G486300	`PF19260`	DUF5903	45	79	0.15	12.8
TkA03G486300	`PF15619`	Lebercilin	118	166	0.49	10.6
TkA03G486300	`PF15619`	Lebercilin	173	331	0.49	10.6
TkA03G486300	`PF19260`	DUF5903	175	218	0.15	12.8
TkA03G486300	`PF15619`	Lebercilin	378	390	0.49	10.6
TkA03G486300	`PF15619`	Lebercilin	504	546	0.49	10.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYX3`	Arabidopsis thaliana	sp\|Q8GYX3\|MP705_ARATH Microtubule-associated protein 70-5	54.700%	Swiss-Prot	High
`Q9LQU7`	Arabidopsis thaliana	sp\|Q9LQU7\|MP704_ARATH Microtubule-associated protein 70-4	50.300%	Swiss-Prot	High
`Q2QLI6`	Oryza sativa subsp. japonica	sp\|Q2QLI6\|MP701_ORYSJ Microtubule-associated protein 70-1	49.300%	Swiss-Prot	Medium
`Q10PZ6`	Oryza sativa subsp. japonica	sp\|Q10PZ6\|MP704_ORYSJ Microtubule-associated protein 70-4	52.800%	Swiss-Prot	High
`Q6Z746`	Oryza sativa subsp. japonica	sp\|Q6Z746\|MP702_ORYSJ Microtubule-associated protein 70-2	51.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card