TkA03G480700 | RubberDandelionOmics

Gene overview

TkA03G480700

Reference: TK1151 Chr: Chr03 Coordinates: 120214275-120219525 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1584 bp · TkA03G480700|TK1151|cDNA

AAAGAAACAAGACCCCTCCACAATGACTCAACTCAAATTTTGTTGTGGTTGAGATCCAACCTCACCACCCTCTCACACTGCAATAAACAAACAATTTCATATCAATCCCATTATTTATCACAACTTGTCTCATCTACCTTCCATCGGAGAATTCAAACTCTCTCATTTTCTCTTTGCCGGAAAAACCTTTTCATGCAGTTAACAATCATCCTATATATATAAACACCTTTAAATTTCACCATCTACAGTGTGATTGTGTG...

CDS

Download CDS FASTA

1275 bp · TkA03G480700|TK1151|CDS

ATGTTAGCTGTTGTGTCACCACTAGAAAACAACACCGGCAGAGATGGAGGTGATCAGATGGTCGGATTTTCTATTGCCGACGACTTCCCGGACTTCTCGGATGATAATTTGTTGGAGAGTATTGACTTTGATGATCTATTTGTGGGGATGGAAGATCGGGATATGCTGCCGGATTTGGAAATGGACCCGGAACTCCTCAACGGCGAATTCTCTCTTAGCGGTGGTGAAGATTCATCTGATCAGTTTAACACCAGTGTGAA...

Protein

Download Protein FASTA

424 aa · TkA03G480700|TK1151|PROTEIN

MLAVVSPLENNTGRDGGDQMVGFSIADDFPDFSDDNLLESIDFDDLFVGMEDRDMLPDLEMDPELLNGEFSLSGGEDSSDQFNTSVNSFSSGDLKAEDLASRKEEVVSKRDRRNEGVATNPGHKEKESDRGRKSSDKSKNSCQGKRKVKVDWTPELHRRFVQAVEQLGVDKAVPSRILEIMGIGCLTRHNIASHLQKYRSHRKHLLAREAEAASWSQRRQMYGGTTAVGGGAGSKREVGPWVAPPATMGFPPMTPVPHYR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G480700`
TK1151 ID	TkA03G480700
OH-1004 ID	LXL04_009895
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 87.500 / OH-1004 88.249 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G480700

Location Chr03:120214275-120219525 (+)

Description Similar to GLK1: Transcription activator GLK1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20570`	Transcriptional activator that functions with GLK2 to promote chloroplast development.	Arabidopsis GARP transcriptional activators interact with the Pro-rich activation domain shared by G-box-binding bZIP factors.2002 · DOI: 10.1093/pcp/pcf011 GLK gene pairs regulate chloroplast development in diverse plant species.2002 · DOI: 10.1046/j.1365-313x.2002.01390.x The GLK1 'regulon' encodes disease defense related proteins and confers resistance to Fusarium graminearum in Arabidopsis.2007 · DOI: 10.1016/j.bbrc.2007.05.084 GLK transcription factors regulate chloroplast development in a cell-autonomous manner.2008 · DOI: 10.1111/j.1365-313x.2008.03616.x GLK transcription factors coordinate expression of the photosynthetic apparatus in Arabidopsis.2009 · DOI: 10.1105/tpc.108.065250 Specialization of the Golden2-like regulatory pathway during land plant evolution.2009 · DOI: 10.1111/j.1469-8137.2009.02829.x Coordination of plastid protein import and nuclear gene expression by plastid-to-nucleus retrograde signaling.2009 · DOI: 10.1104/pp.109.145987 ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription.2013 · DOI: 10.1038/embor.2013.24
`At5g44190`	Transcriptional activator that functions with GLK1 to promote chloroplast development.	Arabidopsis GARP transcriptional activators interact with the Pro-rich activation domain shared by G-box-binding bZIP factors.2002 · DOI: 10.1093/pcp/pcf011 GLK gene pairs regulate chloroplast development in diverse plant species.2002 · DOI: 10.1046/j.1365-313x.2002.01390.x GLK transcription factors regulate chloroplast development in a cell-autonomous manner.2008 · DOI: 10.1111/j.1365-313x.2008.03616.x GLK transcription factors coordinate expression of the photosynthetic apparatus in Arabidopsis.2009 · DOI: 10.1105/tpc.108.065250 Specialization of the Golden2-like regulatory pathway during land plant evolution.2009 · DOI: 10.1111/j.1469-8137.2009.02829.x ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription.2013 · DOI: 10.1038/embor.2013.24
`At4g18020`	Transcriptional activator that binds specifically to the DNA sequence 5'-[AG]GATT-3'.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0348800`	Probable transcriptional activator that promotes chloroplast development.	Ectopic overexpression of the transcription factor OsGLK1 induces chloroplast development in non-green rice cells.2009 · DOI: 10.1093/pcp/pcp138
`Os01g0239000`	Probable transcriptional activator that promotes chloroplast development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009895 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000160 phosphorelay signal transduction system Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0007165 signal transduction Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0010380 regulation of chlorophyll biosynthetic process Biological Process

GO:0010638 positive regulation of organelle organization Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:1900056 negative regulation of leaf senescence Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G20570

ath:AT4G18020

ath:AT5G44190

dosa:Os01g0239000

dosa:Os06g0348800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.978

Rank 1 · TkA03G480700 · TK1151

Cytoplasm0.082

Rank 2 · TkA03G480700 · TK1151

Cell membrane0.026

Rank 3 · TkA03G480700 · TK1151

Endoplasmic reticulum0.018

Rank 4 · TkA03G480700 · TK1151

Plastid0.010

Rank 5 · TkA03G480700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding149-199 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G480700	`PF00249`	Myb_DNA-binding	149	199	1.4e-08	35.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIV3`	Arabidopsis thaliana	sp\|Q9SIV3\|GLK1_ARATH Transcription activator GLK1	50.500%	Swiss-Prot	High
`Q9FFH0`	Arabidopsis thaliana	sp\|Q9FFH0\|GLK2_ARATH Transcription activator GLK2	45.500%	Swiss-Prot	Medium
`Q6LA43`	Arabidopsis thaliana	sp\|Q6LA43\|APRR2_ARATH Two-component response regulator-like APRR2	36.400%	Swiss-Prot	Medium
`Q5Z5I4`	Oryza sativa subsp. japonica	sp\|Q5Z5I4\|GLK1_ORYSJ Probable transcription factor GLK1	45.000%	Swiss-Prot	Medium
`Q5NAN5`	Oryza sativa subsp. japonica	sp\|Q5NAN5\|GLK2_ORYSJ Probable transcription factor GLK2	50.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card