Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2122 bp · TkA03G480020|TK1151|cDNA
TTATTTTTAAACATTTTTGTAAATATTTATAATCATTTTTTGTATTTTATAATTGTCATATTTAAAACAAAAAACGTAAATTTCGCATATTATCCTTTAAAAGGAGTATGATATTTAAATTTTAAGTTGACTAAATACCAAATACCATTTTGTCATTTAACAAAAATATATAACCCAATAATTTACAAGTTTTACTTGTTTTCTATACACGTTATTGAATATTTCATTCGATCACTCATTTCCGCGCCCCTTTGGACTTT...
1596 bp · TkA03G480020|TK1151|CDS
ATGGCTCCGGCGAGCGGTACCGTCTCCAGTGAAGATCACCTCTTACCACATCTCTGGTCGATTAAAGCGGTCCTAGACAAGCTGGATTTATCACAAAATGACGGGGCGGATGTATACGAACTTGTATCTCACTGCATCAAAACCTTCAAGCATAATCCAGATTATCGAAACGATATCAGATTTCTCAAGATTTGGCTCATATATATGGATTTTAGTCCAAACTATGAGCTTGTTTTCAGAGAAATTGAACAGCTTAAAAT...
Protein
Download Protein FASTA531 aa · TkA03G480020|TK1151|PROTEIN
MAPASGTVSSEDHLLPHLWSIKAVLDKLDLSQNDGADVYELVSHCIKTFKHNPDYRNDIRFLKIWLIYMDFSPNYELVFREIEQLKICLDKALLYESYALFLEAKGMMDEAHLVYLSGISRVKFCFRNAEPIEHLKKAHAYFLERMQAIIDSCTHNKINGGSTLNSGSSYMNPWSISTINNLLQKMNSQISKYEGYRASSKCYPGKVPLSSLQKSARNKVIDIGGKKYQIKGCAGKGGFAQVYKACINNNADDLVALKIQ...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G480020 |
|---|---|
| TK1151 ID | TkA03G480020 |
| OH-1004 ID | LXL04_009886 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 98.152Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G480020 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:120044570-120049026 (-) | |||||||||
| Description | Similar to BUB1: Mitotic checkpoint serine/threonine-protein kinase BUB1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0007059 chromosome segregation Biological Process GO:0007063 regulation of sister chromatid cohesion Biological Process GO:0007094 mitotic spindle assembly checkpoint signaling Biological Process GO:0016236 macroautophagy Biological Process GO:0031134 sister chromatid biorientation Biological Process GO:0034501 protein localization to kinetochore Biological Process GO:0045143 homologous chromosome segregation Biological Process GO:0051301 cell division Biological Process GO:0051754 meiotic sister chromatid cohesion, centromeric Biological Process GO:0051983 regulation of chromosome segregation Biological Process GO:1905318 meiosis I spindle assembly checkpoint signaling Biological Process GO:1990758 mitotic sister chromatid biorientation Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT2G20635 hsa:699 mmu:12235 sce:YGR188C spo:2538736 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF08311Mad3_BUB1_I10-119 aaPF00069Pkinase228-445 aaPF07714PK_Tyr_Ser-Thr234-363 aaPF03109ABC1238-263 aaPF14531Kinase-like302-362 aaPF03109ABC1340-365 aaPF01636APH347-362 aaPF14531Kinase-like418-442 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G480020 | PF08311 | Mad3_BUB1_I | 10 | 119 | 9e-22 | 78.0 |
| TkA03G480020 | PF00069 | Pkinase | 228 | 445 | 6.2e-14 | 52.7 |
| TkA03G480020 | PF07714 | PK_Tyr_Ser-Thr | 234 | 363 | 0.0009 | 19.3 |
| TkA03G480020 | PF03109 | ABC1 | 238 | 263 | 0.027 | 14.3 |
| TkA03G480020 | PF14531 | Kinase-like | 302 | 362 | 0.038 | 14.0 |
| TkA03G480020 | PF03109 | ABC1 | 340 | 365 | 0.027 | 14.3 |
| TkA03G480020 | PF01636 | APH | 347 | 362 | 0.16 | 12.4 |
| TkA03G480020 | PF14531 | Kinase-like | 418 | 442 | 0.038 | 14.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.