TkA03G468340 | RubberDandelionOmics

Gene overview

TkA03G468340

Reference: TK1151 Chr: Chr03 Coordinates: 117031112-117035436 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3507 bp · TkA03G468340|TK1151|cDNA

CTCAACCCCAAAACCTATTCTTTTCACAAACTCTTTACTTCAATGCCATGTTTGATTTCTTCAATCTCAAAGCAATATCGTTCTGGTGATGCACTGGAATCACAACGCTTCGCCATATTCTTGTTTCATGGATTATGCTGTTTAAATCCGGGCTCAGAAGTCGAGATGCAGCATTGGCGAATGTTGTTTGTCTTTGGATTAATGTTTTGTTGGTGGTGATTTATATTCAGATTTCTTCCTCAAGTAAAAGCGAAGGTTAA...

CDS

Download CDS FASTA

1800 bp · TkA03G468340|TK1151|CDS

ATGATGGTTTATGCACACAACAACACCAAAATCATTGTAGAACAGACACCTCTTGAAGTTTCAGTTTCACCAGGTTGGGTTGAAGATCATCAAAATCCATCCATCCCTCAAGTCATGAACTCAGACGAGAAACCTAGTTTAGTCAACTCTTTGGAAATCAAGAAAGAGGAGGTTTGTGAGACTGCAAAATTAGGGGATTTGATTCAGGAAGGTATTGGTCGAGTTAGTTTAACTTCAGGTGTTGATGATGTAATTCATGG...

Protein

Download Protein FASTA

599 aa · TkA03G468340|TK1151|PROTEIN

MMVYAHNNTKIIVEQTPLEVSVSPGWVEDHQNPSIPQVMNSDEKPSLVNSLEIKKEEVCETAKLGDLIQEGIGRVSLTSGVDDVIHGLGSSEVTGSQETETPNNDDDNGVKNDGEKVGGDLEESKDSDSDLEEDDSSSSSSSSSSSDDDEEEEEEEEEEEDDDDDDDDDDEEESLKGEKKVKSEVEMEEGEIRDFEVEDDDDDDDDDVKGPIRSKNEVQNLPPVPPVTVTIEPHHKTLPVGVILSIMGPQVIVEGVENHN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G468340`
TK1151 ID	TkA03G468340
OH-1004 ID	LXL04_009749
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.800
Protein coverage (%)	TK1151 91.987 / OH-1004 71.605 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G468340`
Location	Chr03:117031112-117035436 (-)
Description	Similar to NAF1: H/ACA ribonucleoprotein complex non-core subunit NAF1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009749` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000454 snoRNA guided rRNA pseudouridine synthesis Biological Process GO:0000493 box H/ACA snoRNP assembly Biological Process GO:0001522 pseudouridine synthesis Biological Process GO:0006364 rRNA processing Biological Process GO:0032212 positive regulation of telomere maintenance via telomerase Biological Process GO:0042254 ribosome biogenesis Biological Process GO:0043489 RNA stabilization Biological Process GO:0090669 telomerase RNA stabilization Biological Process GO:0090671 telomerase RNA localization to Cajal body Biological Process GO:1904358 positive regulation of telomere maintenance via telomere lengthening Biological Process GO:1905323 telomerase holoenzyme complex assembly Biological Process GO:0005634 nucleus Cellular Component
KEGG gene cross-reference	dme:Dmel_CG10341 hsa:92345 mmu:234344 rno:306387 spo:2540349 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.891

Rank 1 · TkA03G468340 · TK1151

Cytoplasm0.223

Rank 2 · TkA03G468340 · TK1151

Cell membrane0.029

Rank 3 · TkA03G468340 · TK1151

Endoplasmic reticulum0.023

Rank 4 · TkA03G468340 · TK1151

Mitochondrion0.014

Rank 5 · TkA03G468340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12722Hid1106-201 aa

PF09073BUD22107-207 aa

PF04410Gar1239-321 aa

PF09073BUD22348-383 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G468340	`PF12722`	Hid1	106	201	0.83	8.5
TkA03G468340	`PF09073`	BUD22	107	207	0.00027	21.1
TkA03G468340	`PF04410`	Gar1	239	321	2.8e-15	56.6
TkA03G468340	`PF09073`	BUD22	348	383	0.00027	21.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card