TkA03G462490 | RubberDandelionOmics

Gene overview

TkA03G462490

Reference: TK1151 Chr: Chr03 Coordinates: 115471632-115473261 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1430 bp · TkA03G462490|TK1151|cDNA

GCATAAAAAATATTTCTAGCCTACAAAATTCAGTTATGGCTATGACTGGCGGTGGTCTTAGACTGGTGTTGCCGCCGTGCTTTTACCACCATCGTAAGACTACATTACGGGTTGAGCAACCGACGAAGGTTTCGATTTGTGCAGCACTGAGTAAACAAGGTCACCGGTTCTTTACATCAGTCGCCACCACCGACGACCCGGCCACCGCCTCTCGGCTGATTCGGAAATTCGTAGCTTCATCCTCTAAATCCGTAGCTCTT...

CDS

Download CDS FASTA

1371 bp · TkA03G462490|TK1151|CDS

ATGGCTATGACTGGCGGTGGTCTTAGACTGGTGTTGCCGCCGTGCTTTTACCACCATCGTAAGACTACATTACGGGTTGAGCAACCGACGAAGGTTTCGATTTGTGCAGCACTGAGTAAACAAGGTCACCGGTTCTTTACATCAGTCGCCACCACCGACGACCCGGCCACCGCCTCTCGGCTGATTCGGAAATTCGTAGCTTCATCCTCTAAATCCGTAGCTCTTGACGCCATCGCTCACCTCGTTTCTCCAGTAAACAC...

Protein

Download Protein FASTA

456 aa · TkA03G462490|TK1151|PROTEIN

MAMTGGGLRLVLPPCFYHHRKTTLRVEQPTKVSICAALSKQGHRFFTSVATTDDPATASRLIRKFVASSSKSVALDAIAHLVSPVNTFTRLSPLAFSLYYEINKASWFNWNAKLISDVIASLHKHQRFNEAHTLILEVETKLGSKERDICNFYCNLMDSHSKHQSKQGILESYERIKQIPSHSSSIYLQKRSYESIIGCLSTIDLPNEAETLMVEMKNKGLKASIFEYRSISYAYGRLGLFEEMKRVIGLMEKEGFKLDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G462490`
TK1151 ID	TkA03G462490
OH-1004 ID	LXL04_009688
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.400
Protein coverage (%)	TK1151 99.561 / OH-1004 99.561 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G462490

Location Chr03:115471632-115473261 (-)

Description Similar to At2g17033: Pentatricopeptide repeat-containing protein At2g17033

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g17033`	Pentatricopeptide repeat-containing protein At2g17033.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009688 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010019 chloroplast-nucleus signaling pathway Biological Process

GO:0031930 mitochondria-nucleus signaling pathway Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G18900

ath:AT1G74750

ath:AT2G17033

ath:AT2G31400

ath:AT5G12100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.730

Rank 1 · TkA03G462490 · TK1151

Plastid0.168

Rank 2 · TkA03G462490 · TK1151

Nucleus0.078

Rank 3 · TkA03G462490 · TK1151

Cytoplasm0.037

Rank 4 · TkA03G462490 · TK1151

Cell membrane0.010

Rank 5 · TkA03G462490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23276TPR_24112-132 aa

PF13041PPR_2118-135 aa

PF01535PPR119-138 aa

PF01535PPR153-163 aa

PF23276TPR_24185-280 aa

PF13041PPR_2192-226 aa

PF01535PPR192-221 aa

PF13812PPR_3212-268 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G462490	`PF23276`	TPR_24	112	132	0.025	15.2
TkA03G462490	`PF13041`	PPR_2	118	135	3.6e-08	34.1
TkA03G462490	`PF01535`	PPR	119	138	0.00011	22.9
TkA03G462490	`PF01535`	PPR	153	163	0.00011	22.9
TkA03G462490	`PF23276`	TPR_24	185	280	0.025	15.2
TkA03G462490	`PF13041`	PPR_2	192	226	3.6e-08	34.1
TkA03G462490	`PF01535`	PPR	192	221	0.00011	22.9
TkA03G462490	`PF13812`	PPR_3	212	268	3e-06	27.9
TkA03G462490	`PF01535`	PPR	231	256	0.00011	22.9
TkA03G462490	`PF13041`	PPR_2	234	260	3.6e-08	34.1
TkA03G462490	`PF23276`	TPR_24	237	309	0.025	15.2
TkA03G462490	`PF13812`	PPR_3	251	305	3e-06	27.9
TkA03G462490	`PF13041`	PPR_2	259	305	3.6e-08	34.1
TkA03G462490	`PF01535`	PPR	264	290	0.00011	22.9
TkA03G462490	`PF01535`	PPR	297	303	0.00011	22.9
TkA03G462490	`PF27457`	RNase_HII_N	307	342	0.25	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GWA9`	Arabidopsis thaliana	sp\|Q8GWA9\|PP157_ARATH Pentatricopeptide repeat-containing protein At2g17033	48.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card