TkA03G460760 | RubberDandelionOmics

Gene overview

TkA03G460760

Reference: TK1151 Chr: Chr03 Coordinates: 115015261-115018504 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1677 bp · TkA03G460760|TK1151|cDNA

CAATCTCTTTGATCATCTTAAGTAATACGAAAATAATACAGTAGTAAGTAGTAACTTTGTTTTGTTCTCAAAACAAAACTCCGTTGAAGAGGCTGTTAATTTCCATGTCCCAACACAAATTGCCACATTGGGGGGAAAAGTTCTCACACGGTTTCAAAACTCCCTCCAAAAACCACCAAAATCTACACAACGATACATCTATCTGACTCAATACAAACAGCATTACGCTACCTTAATCAGTCCAACAATTGAATCCATCA...

CDS

Download CDS FASTA

1206 bp · TkA03G460760|TK1151|CDS

ATGTCAACACACGGTGACGATCTCGATCTTCTTCTTTCCCTTCAAGACAGGGTGCTAGAAACCCCTCCGTCATCACCGTCGCCCCATTCACCTGGATATCTATCTGATGATGGATCTACGAGGCACAGGGGACATGGGGACATGTCTGCTTTTAGAACTGCTGTTGAGGATTGTCTAGACTATGAACCTGAACCCTCCAAGAAACCATTAAAATCAAAACATTCAAAAAGCTCAAGTAATGTTGAGGTTGAAACATTCTC...

Protein

Download Protein FASTA

401 aa · TkA03G460760|TK1151|PROTEIN

MSTHGDDLDLLLSLQDRVLETPPSSPSPHSPGYLSDDGSTRHRGHGDMSAFRTAVEDCLDYEPEPSKKPLKSKHSKSSSNVEVETFSGLKIRNMLVSKTELSDRLADIRFVRLTAIKTLLSGDTLSGCWATIGVLCEKGQIRTSSTGKPYSIWTFGCLDEKTVSVFLFGNTYQKNSKEEVGTIFALFNCGVRKDAKSKSGFTLTVFSAPQVLKLGTSAEFGQCKTCNVVINKRNGEYCKYHKKNASEKYSTKRMEFMGGN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G460760`
TK1151 ID	TkA03G460760
OH-1004 ID	LXL04_009660
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G460760`
Location	Chr03:115015261-115018504 (-)
Description	Similar to Mcm10: Protein MCM10 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009660` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006270 DNA replication initiation Biological Process GO:0006974 DNA damage response Biological Process GO:0008283 cell population proliferation Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0043596 nuclear replication fork Cellular Component GO:0003688 DNA replication origin binding Molecular Function GO:0003690 double-stranded DNA binding Molecular Function GO:0003697 single-stranded DNA binding Molecular Function GO:0008270 zinc ion binding Molecular Function GO:0019899 enzyme binding Molecular Function
KEGG gene cross-reference	dre:553396 hsa:55388 mmu:70024 xla:398196 xtr:549663 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.949

Rank 1 · TkA03G460760 · TK1151

Cytoplasm0.136

Rank 2 · TkA03G460760 · TK1151

Mitochondrion0.024

Rank 3 · TkA03G460760 · TK1151

Cell membrane0.017

Rank 4 · TkA03G460760 · TK1151

Golgi apparatus0.007

Rank 5 · TkA03G460760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22379OB_MCM1086-212 aa

PF17032Zn_ribbon_15189-249 aa

PF09329zf-primase215-253 aa

PF29900DUF8602225-253 aa

PF17160DUF5124245-315 aa

PF17160DUF5124359-376 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G460760	`PF22379`	OB_MCM10	86	212	1.9e-49	167.5
TkA03G460760	`PF17032`	Zn_ribbon_15	189	249	0.11	14.1
TkA03G460760	`PF09329`	zf-primase	215	253	3.8e-08	33.6
TkA03G460760	`PF29900`	DUF8602	225	253	0.096	13.5
TkA03G460760	`PF17160`	DUF5124	245	315	0.035	15.6
TkA03G460760	`PF17160`	DUF5124	359	376	0.035	15.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card