TkA03G454520 | RubberDandelionOmics

Gene overview

TkA03G454520

Reference: TK1151 Chr: Chr03 Coordinates: 113437345-113441374 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2082 bp · TkA03G454520|TK1151|cDNA

CAACAGAAAACAATTTTTCGAGCTTCTGCCCTAACAACTAGTTTTAACTCAAGCCACATTGATATCATTTGGCACATGATCGAGAAAAGCGAAAGTTGGGGATTAGGAATGGTTAGTAAAAGAAGCTACACATAGTTCTGACCGCCAGCCAAGATAATTTTCATTGTTGGGGAACTGCGAGTCAATTAGTTGGTCTATTTTGTTCTAGGAACAGAGGACAAATGATTTGCGTCTGGGGGTGATGAGATAAAATATAATAA...

CDS

Download CDS FASTA

1398 bp · TkA03G454520|TK1151|CDS

ATGGCATCTTCGGCGTCGTTGCTTCATTACACAACACCTCCCGTGATTAATCTTCGAAGAAGCGCTAATTTAGGTTCATCGCCCTCCAATCCAACACCGAATTCGCCGTCTTCTTCTTCATCTACGTGTTCTTCGTCCTCGTCCTGGCCGTGTTGTCAGGGATTTTCGTGGACTTTCTCCAACTGTTTTGGCATACACGCGGTCTGGAAAAATCAAAGCTTTAAAGCTCAAGCTATGAGCACAACCCAAGGGCATTTTGT...

Protein

Download Protein FASTA

465 aa · TkA03G454520|TK1151|PROTEIN

MASSASLLHYTTPPVINLRRSANLGSSPSNPTPNSPSSSSSTCSSSSSWPCCQGFSWTFSNCFGIHAVWKNQSFKAQAMSTTQGHFVSSTSGVKEEPDHLLVLVHGIYASPNDWRYVEGELKRRLGRHFLIYASSSNTYSKTFGGIDGAGKRLADEVKQIVKSRDSLKRISFLAHSLGGLIARYAVADLYTHTNNNNNNNNNNNDNATSSAIDNNNNNKVDGTIAGLEGINFITLATPHLGVRGNKQLPFLLGVPILEKI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G454520`
TK1151 ID	TkA03G454520
OH-1004 ID	LXL04_034456
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.000
Protein coverage (%)	TK1151 99.570 / OH-1004 90.440 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G454520`
Location	Chr03:113437345-113441374 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_034456` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006629 lipid metabolic process Biological Process
KEGG gene cross-reference	mmu:70363 xla:447696 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.936

Rank 1 · TkA03G454520 · TK1151

Mitochondrion0.058

Rank 2 · TkA03G454520 · TK1151

Cytoplasm0.034

Rank 3 · TkA03G454520 · TK1151

Nucleus0.033

Rank 4 · TkA03G454520 · TK1151

Cell membrane0.023

Rank 5 · TkA03G454520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15725RCDG126-54 aa

PF05057DUF67695-329 aa

PF00561Abhydrolase_1100-188 aa

PF12697Abhydrolase_6101-184 aa

PF02089Palm_thioest102-189 aa

PF22575Vir1p192-221 aa

PF02863Arg_repressor_C206-227 aa

PF02089Palm_thioest231-248 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G454520	`PF15725`	RCDG1	26	54	5.3	8.3
TkA03G454520	`PF05057`	DUF676	95	329	1.9e-66	224.4
TkA03G454520	`PF00561`	Abhydrolase_1	100	188	0.0003	21.3
TkA03G454520	`PF12697`	Abhydrolase_6	101	184	0.00018	23.0
TkA03G454520	`PF02089`	Palm_thioest	102	189	0.0048	17.4
TkA03G454520	`PF22575`	Vir1p	192	221	0.34	9.3
TkA03G454520	`PF02863`	Arg_repressor_C	206	227	0.14	12.7
TkA03G454520	`PF02089`	Palm_thioest	231	248	0.0048	17.4
TkA03G454520	`PF02089`	Palm_thioest	422	455	0.0048	17.4
TkA03G454520	`PF05057`	DUF676	433	465	1.9e-66	224.4
TkA03G454520	`PF02863`	Arg_repressor_C	438	452	0.14	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card