TkA03G451230 | RubberDandelionOmics

Gene overview

TkA03G451230

Reference: TK1151 Chr: Chr03 Coordinates: 112600777-112606483 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3725 bp · TkA03G451230|TK1151|cDNA

CTGATTGATTACGCGCGTTTCCCACAATAACAGCCACCAATCCATGACACGTCAGCAACGTCACCGGATTAACCAACGTTGATATCTTGGTCACTCACTCTCTTCTCTATCCAAACACTCACACACTCTTCCATATCCAAATCCTCCTCAGATGGATGTGAGCTCTGTTTTCTTTGTAAAACCAAATCAACATCCATTATCGTCCTCCTCCTTCACTTCTTGCATTTCTCCGACCATCTCCTTACGCCCGGAGTTCTTTG...

CDS

Download CDS FASTA

1776 bp · TkA03G451230|TK1151|CDS

ATGGATGTGAGCTCTGTTTTCTTTGTAAAACCAAATCAACATCCATTATCGTCCTCCTCCTTCACTTCTTGCATTTCTCCGACCATCTCCTTACGCCCGGAGTTCTTTGGCCCTGAATTTCGTCGTCCTTCCCGCCGGAAAAAATGCTGCAGCCTTGGGCTAGGGTTAGGCTTGGGGGTTCATTTTCATTCTCCGTCGATTAGAACAAAAAGGAGGACTGTCTTCAGAACATCTGCGGCTTTGGATGTGCAAACGATTGT...

Protein

Download Protein FASTA

591 aa · TkA03G451230|TK1151|PROTEIN

MDVSSVFFVKPNQHPLSSSSFTSCISPTISLRPEFFGPEFRRPSRRKKCCSLGLGLGLGVHFHSPSIRTKRRTVFRTSAALDVQTIVVVVSFVAVSALTVYYFNYSNKKHDDGSNKVSKPIEHTDSQQSSSIVNHTLNGQKPSVIVLQREHHDDESKDIVTEVKTIIHDIADEPAEIHSNGKVSQTISALASSGPDTIATESSDVKSSFTKDLIMLESSFKEPHNVMELSSQKSSLSMVIESGDVSCIPPSERTVVCFDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G451230`
TK1151 ID	TkA03G451230
OH-1004 ID	LXL04_009612
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.900
Protein coverage (%)	TK1151 89.848 / OH-1004 47.705 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G451230

Location Chr03:112600777-112606483 (-)

Description Similar to MRL1: Pentatricopeptide repeat-containing protein MRL1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q0WLC6`	Regulator of the large subunit (LS) of RuBisCO.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009612 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0010239 chloroplast mRNA processing Biological Process

GO:0048255 mRNA stabilization Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0048027 mRNA 5'-UTR binding Molecular Function

KEGG gene cross-reference

ath:AT4G34830

ath:AT5G39710

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.959

Rank 1 · TkA03G451230 · TK1151

Nucleus0.041

Rank 2 · TkA03G451230 · TK1151

Mitochondrion0.031

Rank 3 · TkA03G451230 · TK1151

Cytoplasm0.026

Rank 4 · TkA03G451230 · TK1151

Cell membrane0.020

Rank 5 · TkA03G451230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10037MRP-S27127-174 aa

PF13041PPR_2435-456 aa

PF01535PPR435-456 aa

PF23276TPR_24435-512 aa

PF13041PPR_2471-485 aa

PF12854PPR_1477-485 aa

PF12854PPR_1489-515 aa

PF13041PPR_2490-539 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G451230	`PF10037`	MRP-S27	127	174	0.077	12.7
TkA03G451230	`PF13041`	PPR_2	435	456	2.6e-21	76.2
TkA03G451230	`PF01535`	PPR	435	456	7.1e-18	64.2
TkA03G451230	`PF23276`	TPR_24	435	512	4.5e-06	27.3
TkA03G451230	`PF13041`	PPR_2	471	485	2.6e-21	76.2
TkA03G451230	`PF12854`	PPR_1	477	485	7.6e-15	55.1
TkA03G451230	`PF12854`	PPR_1	489	515	7.6e-15	55.1
TkA03G451230	`PF13041`	PPR_2	490	539	2.6e-21	76.2
TkA03G451230	`PF13812`	PPR_3	492	524	1.3e-13	51.5
TkA03G451230	`PF01535`	PPR	493	523	7.1e-18	64.2
TkA03G451230	`PF29070`	MSC6_N	493	581	0.00011	22.2
TkA03G451230	`PF17177`	PPR_long	494	589	2.3e-09	37.6
TkA03G451230	`PF23276`	TPR_24	499	564	4.5e-06	27.3
TkA03G451230	`PF13812`	PPR_3	514	572	1.3e-13	51.5
TkA03G451230	`PF12854`	PPR_1	522	554	7.6e-15	55.1
TkA03G451230	`PF10037`	MRP-S27	526	582	0.077	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WLC6`	Arabidopsis thaliana	sp\|Q0WLC6\|PP349_ARATH Pentatricopeptide repeat-containing protein MRL1, chloroplastic	51.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card