Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2427 bp · TkA03G445260|TK1151|cDNA
ATGGGTGGCGTAAGGAGCACAATCTTCCTGTTCATATTACTGAAACTTTCAATCACAATCGCTTCAAATGATTCATTCTGGCTACTCAAAATCCAATCCGAATTCATCGATTCAACGGGAGTTTTCAAAAACTGGTCGCCGGGATCAAATATATGCACATGGAACGGCGTCGAATGTTCAGAAGATGATCAGACACGTGTCGTGGGTATAAACCTTTCAAATTCAGGACTCTCGGGGATAATTTCTCCCGATTTTTCAAA...
2427 bp · TkA03G445260|TK1151|CDS
ATGGGTGGCGTAAGGAGCACAATCTTCCTGTTCATATTACTGAAACTTTCAATCACAATCGCTTCAAATGATTCATTCTGGCTACTCAAAATCCAATCCGAATTCATCGATTCAACGGGAGTTTTCAAAAACTGGTCGCCGGGATCAAATATATGCACATGGAACGGCGTCGAATGTTCAGAAGATGATCAGACACGTGTCGTGGGTATAAACCTTTCAAATTCAGGACTCTCGGGGATAATTTCTCCCGATTTTTCAAA...
Protein
Download Protein FASTA808 aa · TkA03G445260|TK1151|PROTEIN
MGGVRSTIFLFILLKLSITIASNDSFWLLKIQSEFIDSTGVFKNWSPGSNICTWNGVECSEDDQTRVVGINLSNSGLSGIISPDFSKLESLQKLDLSVNSLTGVIPKKLGELRELQELYLFSNYLTGSMPGEIIESIGELSELRVLGLAYCQFNGSIPSQIGKLKLLKSLQLQTNNLGGKIPEEVLNCSSLEVLDISGNDFGNEIPSGVENLKNLTDLLLNNNSFSGGLPREIGNLSNLVNLYLFGNKITGEIPIEIGKL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G445260 |
|---|---|
| TK1151 ID | TkA03G445260 |
| OH-1004 ID | LXL04_009530 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 73.300 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G445260 |
|---|---|
| Location | Chr03:111039917-111042835 (+) |
| Description | Similar to GSO1: LRR receptor-like serine/threonine-protein kinase GSO1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0009553 embryo sac development Biological Process GO:0009611 response to wounding Biological Process GO:0042659 regulation of cell fate specification Biological Process GO:0045184 establishment of protein localization Biological Process GO:0051302 regulation of cell division Biological Process GO:0055075 potassium ion homeostasis Biological Process GO:0090708 specification of plant organ axis polarity Biological Process GO:0160073 Casparian strip assembly Biological Process GO:2000067 regulation of root morphogenesis Biological Process GO:2000280 regulation of root development Biological Process GO:0005886 plasma membrane Cellular Component GO:0009507 chloroplast Cellular Component |
| KEGG gene cross-reference | ath:AT4G20140 ath:AT5G44700 ath:AT5G63930 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF08263LRRNT_222-60 aaPF29594LRR_SKP260-156 aaPF00560LRR_170-88 aaPF13855LRR_870-125 aaPF12799LRR_470-101 aaPF25013LRR_Zer-185-149 aaPF24048LRR_NXF1-585-126 aaPF23598LRR_1486-146 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G445260 | PF08263 | LRRNT_2 | 22 | 60 | 5.4e-08 | 33.7 |
| TkA03G445260 | PF29594 | LRR_SKP2 | 60 | 156 | 0.00049 | 20.2 |
| TkA03G445260 | PF00560 | LRR_1 | 70 | 88 | 1.6e-64 | 200.5 |
| TkA03G445260 | PF13855 | LRR_8 | 70 | 125 | 2.9e-45 | 152.6 |
| TkA03G445260 | PF12799 | LRR_4 | 70 | 101 | 1e-35 | 121.6 |
| TkA03G445260 | PF25013 | LRR_Zer-1 | 85 | 149 | 0.00066 | 20.6 |
| TkA03G445260 | PF24048 | LRR_NXF1-5 | 85 | 126 | 4.5 | 7.6 |
| TkA03G445260 | PF23598 | LRR_14 | 86 | 146 | 1.6e-42 | 146.3 |
| TkA03G445260 | PF23211 | LRR_LRWD1 | 86 | 147 | 0.0014 | 19.1 |
| TkA03G445260 | PF13516 | LRR_6 | 89 | 102 | 0.0003 | 21.3 |
| TkA03G445260 | PF00560 | LRR_1 | 90 | 112 | 1.6e-64 | 200.5 |
| TkA03G445260 | PF12799 | LRR_4 | 90 | 125 | 1e-35 | 121.6 |
| TkA03G445260 | PF29252 | LRR_NLRC4 | 106 | 148 | 0.024 | 14.6 |
| TkA03G445260 | PF24758 | LRR_At5g56370 | 112 | 199 | 8.8e-11 | 42.6 |
| TkA03G445260 | PF00560 | LRR_1 | 115 | 133 | 1.6e-64 | 200.5 |
| TkA03G445260 | PF23598 | LRR_14 | 135 | 266 | 1.6e-42 | 146.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.