TkA03G443230 | RubberDandelionOmics

Gene overview

TkA03G443230

Reference: TK1151 Chr: Chr03 Coordinates: 110501253-110503275 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1731 bp · TkA03G443230|TK1151|cDNA

TATCCATTGACCTTTCATTATAGCTAAACTCATTTGCGTAAAAATAAAAACGGTATTTGATCACAAAGGAAAAATAAAAGAAAAAATAGGACGAGAACTTGTCAACTTGAAGCTACTGATCGTCAACGGCGGGGATTTCTAGAGCTCGAACATCATGACGGAATTGTTTAAACGAAGTCGGTAGTCATCAGCGCAAGAAAGAGGTTCGGTTTGGTTGTAAAATGGAACATTACAAGTCCCGAAACAACGATTTCTTCCAC...

CDS

Download CDS FASTA

1167 bp · TkA03G443230|TK1151|CDS

ATGGAACATTACAAGTCCCGAAACAACGATTTCTTCCACTTCACAAACCCTCATGATGATGCTAGTGAGGTAGATGATTATGATGATGATGATTACGATGAACTGCAGTACGACGATGTAGATGATGATCGTAGCTGTGATTTTAATTTCCATAATTTTCGTCCCATCGGGAGTACTCCATTTCTACCTCCTAATTCCCAGACAAGTGGTGTGATGAACCAGAATGATACCGTGACCGCATCCATGGAGAAACTTGTGAC...

Protein

Download Protein FASTA

388 aa · TkA03G443230|TK1151|PROTEIN

MEHYKSRNNDFFHFTNPHDDASEVDDYDDDDYDELQYDDVDDDRSCDFNFHNFRPIGSTPFLPPNSQTSGVMNQNDTVTASMEKLVTFDHRPLISHLDNTMKNLSDKLQHTIEGISTRISNLEDETCKLDKHVEIFKNLAEKHHGTTHINLRQMQNVLQEVQDDVLFLKDKHEIAETKLQLAKLQSSKKNKVPNVNKPLSQPPSNEPSFSQKFPHFTQSYQINPFQGSCSPQNHPFLNHNPQQPPYTSSSVQQSWGPTQE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G443230`
TK1151 ID	TkA03G443230
OH-1004 ID	LXL04_009509
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G443230`
Location	Chr03:110501253-110503275 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009509` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.660

Rank 1 · TkA03G443230 · TK1151

Nucleus0.372

Rank 2 · TkA03G443230 · TK1151

Cell membrane0.071

Rank 3 · TkA03G443230 · TK1151

Endoplasmic reticulum0.060

Rank 4 · TkA03G443230 · TK1151

Golgi apparatus0.052

Rank 5 · TkA03G443230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24430DUF755371-106 aa

PF04513Baculo_PEP_C74-123 aa

PF02601Exonuc_VII_L84-191 aa

PF06825HSBP193-124 aa

PF07889DUF166495-173 aa

PF08702Fib_alpha97-192 aa

PF28256CCDC17199-192 aa

PF28219Spindly99-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G443230	`PF24430`	DUF7553	71	106	0.03	15.6
TkA03G443230	`PF04513`	Baculo_PEP_C	74	123	2.5	8.9
TkA03G443230	`PF02601`	Exonuc_VII_L	84	191	0.15	12.3
TkA03G443230	`PF06825`	HSBP1	93	124	0.59	10.7
TkA03G443230	`PF07889`	DUF1664	95	173	1.4	9.7
TkA03G443230	`PF08702`	Fib_alpha	97	192	0.77	10.7
TkA03G443230	`PF28256`	CCDC171	99	192	0.026	12.7
TkA03G443230	`PF28219`	Spindly	99	188	0.37	10.3
TkA03G443230	`PF05377`	FlaC_arch	106	134	2.3	9.4
TkA03G443230	`PF25450`	Rab11-FIP3	108	177	0.7	10.9
TkA03G443230	`PF24430`	DUF7553	128	164	0.03	15.6
TkA03G443230	`PF09288`	UBA_3	130	143	0.28	11.8
TkA03G443230	`PF22560`	GMT-wHTH	136	163	0.024	15.7
TkA03G443230	`PF28719`	Dhx29_hel	140	170	1.1	10.5
TkA03G443230	`PF05377`	FlaC_arch	147	166	2.3	9.4
TkA03G443230	`PF06825`	HSBP1	152	163	0.59	10.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card