TkA03G437670 | RubberDandelionOmics

Gene overview

TkA03G437670

Reference: TK1151 Chr: Chr03 Coordinates: 108847804-108849283 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

384 bp · TkA03G437670|TK1151|cDNA

ATGAGTACAAATGCCAGTGACTTGAGTTACACGATGAATATCTACAAACATATGCAATTAACTATTCAGAATCCAGGTGTTGCTCCGGATATAACAGCATACAATATCCTTCTAAAATCATGTTTCCTTATTGCTAGAGTCGATCTGGCCCAGGAAATTTACAGCGAGGTAGAATACATGAAATCAACAGGATCATTGAAGTTAGATGTGTTCACATACAGCACAATGATTAAGGATGGAACTCTTAATGTGCCTGAGGT...

CDS

Download CDS FASTA

384 bp · TkA03G437670|TK1151|CDS

ATGAGTACAAATGCCAGTGACTTGAGTTACACGATGAATATCTACAAACATATGCAATTAACTATTCAGAATCCAGGTGTTGCTCCGGATATAACAGCATACAATATCCTTCTAAAATCATGTTTCCTTATTGCTAGAGTCGATCTGGCCCAGGAAATTTACAGCGAGGTAGAATACATGAAATCAACAGGATCATTGAAGTTAGATGTGTTCACATACAGCACAATGATTAAGGATGGAACTCTTAATGTGCCTGAGGT...

Protein

Download Protein FASTA

127 aa · TkA03G437670|TK1151|PROTEIN

MSTNASDLSYTMNIYKHMQLTIQNPGVAPDITAYNILLKSCFLIARVDLAQEIYSEVEYMKSTGSLKLDVFTYSTMIKDGTLNVPEVEDLFLVHQKVPEVKLHLQLQQRETHRAGYHLMDFYQRYNI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G437670`
TK1151 ID	TkA03G437670
OH-1004 ID	LXL04_012648
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	85.900
Protein coverage (%)	TK1151 61.417 / OH-1004 9.409 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G437670

Location Chr03:108847804-108849283 (-)

Description Similar to At5g02830: Pentatricopeptide repeat-containing protein At5g02830, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g02830`	Pentatricopeptide repeat-containing protein At5g02830, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012648 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0006412 translation Biological Process

GO:0032544 plastid translation Biological Process

GO:0043489 RNA stabilization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G31850

ath:AT5G02830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.458

Rank 1 · TkA03G437670 · TK1151

Cytoplasm0.220

Rank 2 · TkA03G437670 · TK1151

Nucleus0.124

Rank 3 · TkA03G437670 · TK1151

Peroxisome0.088

Rank 4 · TkA03G437670 · TK1151

Plastid0.035

Rank 5 · TkA03G437670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13812PPR_323-58 aa

PF12854PPR_126-56 aa

PF13041PPR_229-78 aa

PF12854PPR_166-78 aa

PF13812PPR_366-100 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G437670	`PF13812`	PPR_3	23	58	0.00059	20.6
TkA03G437670	`PF12854`	PPR_1	26	56	1.2e-05	25.7
TkA03G437670	`PF13041`	PPR_2	29	78	3.5e-06	27.7
TkA03G437670	`PF12854`	PPR_1	66	78	1.2e-05	25.7
TkA03G437670	`PF13812`	PPR_3	66	100	0.00059	20.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYL7`	Arabidopsis thaliana	sp\|Q8GYL7\|PP361_ARATH Pentatricopeptide repeat-containing protein At5g02830, chloroplastic	55.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card