TkA03G431300 | RubberDandelionOmics

Gene overview

TkA03G431300

Reference: TK1151 Chr: Chr03 Coordinates: 107367495-107368019 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

483 bp · TkA03G431300|TK1151|cDNA

ATGGAAGATGATCAAAGGGAACTACAGCTACTCCCTACGCCGCCGCACACCAGAGGACCGTACTCACGCCCGACGCCATGGAAGTCTGATTCTATGAGATACCGATCCGATAACAACATCCAGTATAATCCTCTAGAGAGTACTGCTGGTCCGTCGCTGGACCTGCAGCTATCGATTAGTCTCCGGCCTATCAAGCCAGACTCTAAAAGCGAGAACGGAAGACTTGAGGCGATGAAATGGCAAGCGGCGGATCAAATTCG...

CDS

Download CDS FASTA

483 bp · TkA03G431300|TK1151|CDS

ATGGAAGATGATCAAAGGGAACTACAGCTACTCCCTACGCCGCCGCACACCAGAGGACCGTACTCACGCCCGACGCCATGGAAGTCTGATTCTATGAGATACCGATCCGATAACAACATCCAGTATAATCCTCTAGAGAGTACTGCTGGTCCGTCGCTGGACCTGCAGCTATCGATTAGTCTCCGGCCTATCAAGCCAGACTCTAAAAGCGAGAACGGAAGACTTGAGGCGATGAAATGGCAAGCGGCGGATCAAATTCG...

Protein

Download Protein FASTA

160 aa · TkA03G431300|TK1151|PROTEIN

MEDDQRELQLLPTPPHTRGPYSRPTPWKSDSMRYRSDNNIQYNPLESTAGPSLDLQLSISLRPIKPDSKSENGRLEAMKWQAADQIRIASMEKAYAERVREMTKREMELAQSEFSRARHMWERAREEVERVEKMKERATRRIDSTCMEITCQACRQKFRH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G431300`
TK1151 ID	TkA03G431300
OH-1004 ID	LXL04_009383
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G431300`
Location	Chr03:107367495-107368019 (-)
Description	Similar to SGR5: Zinc finger protein SHOOT GRAVITROPISM 5
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009383` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0009590 detection of gravity Biological Process GO:0009630 gravitropism Biological Process GO:0009959 negative gravitropism Biological Process GO:0009965 leaf morphogenesis Biological Process GO:0010031 circumnutation Biological Process GO:0010601 positive regulation of auxin biosynthetic process Biological Process GO:0048444 floral organ morphogenesis Biological Process GO:2000012 regulation of auxin polar transport Biological Process GO:2000122 negative regulation of stomatal complex development Biological Process GO:2000904 regulation of starch metabolic process Biological Process
KEGG gene cross-reference	ath:AT1G25250 ath:AT1G68130 ath:AT2G01940 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.562

Rank 1 · TkA03G431300 · TK1151

Cytoplasm0.442

Rank 2 · TkA03G431300 · TK1151

Cell membrane0.180

Rank 3 · TkA03G431300 · TK1151

Endoplasmic reticulum0.032

Rank 4 · TkA03G431300 · TK1151

Lysosome / Vacuole0.022

Rank 5 · TkA03G431300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15437PGBA_C65-105 aa

PF10112Halogen_Hydrol91-140 aa

PF05276SH3BP596-154 aa

PF15437PGBA_C103-137 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G431300	`PF15437`	PGBA_C	65	105	3.4	8.8
TkA03G431300	`PF10112`	Halogen_Hydrol	91	140	0.027	15.2
TkA03G431300	`PF05276`	SH3BP5	96	154	0.0043	17.6
TkA03G431300	`PF15437`	PGBA_C	103	137	3.4	8.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card