TkA03G418720 | RubberDandelionOmics

Gene overview

TkA03G418720

Reference: TK1151 Chr: Chr03 Coordinates: 104238369-104240636 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1462 bp · TkA03G418720|TK1151|cDNA

CCATTTTCTGACAGCAACTTGCTTCCATTTTTCATAAGTGTCAATTTATCTCCTTTCTGCAATTTATTGTATATTTGCCATTGTCGAAGTTTTTTTCGATTTGAGCCGGAAGCCCATTAATAAGATTGATATCATGCTACCAAATGTCATTGATACATCCACTGTTTGCAACGATTTGACCTTAAACTCTGATGTTTTGAGAACTTCAATTATAAACCACATCTCTTAGTTGGGGCAGGCTGCCTTGCTTTTGGATTCTT...

CDS

Download CDS FASTA

387 bp · TkA03G418720|TK1151|CDS

ATGCAACAAAGTATTAGATGCGAATCTGTTCACGTGAAAGCACTGAAAGCACTTAATCGTAGAGGAATGGCGTACATGGAAGTTGGTGATTATGAAGAAGCAAGAACAGATTTCAACAAAATGATGACAATAGACAAGTCATCAGAAGTCAACGCAAAGTCAGCACTTCTGAAACTAAAGCAAATAGAACAAGAAGTAGAAAAGAAAGCAAGAAAGCAATTCAAAGGACTATTTGACGAGAAGCCTGGCGAGATCTCAGA...

Protein

Download Protein FASTA

128 aa · TkA03G418720|TK1151|PROTEIN

MQQSIRCESVHVKALKALNRRGMAYMEVGDYEEARTDFNKMMTIDKSSEVNAKSALLKLKQIEQEVEKKARKQFKGLFDEKPGEISDVGVTDTVTESKNEGAQEPLISMREMHGKFLVLVAWDPFRGC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G418720`
TK1151 ID	TkA03G418720
OH-1004 ID	LXL04_016137
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.000
Protein coverage (%)	TK1151 77.344 / OH-1004 27.988 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G418720

Location Chr03:104238369-104240636 (-)

Description Similar to PAS1: Peptidyl-prolyl cis-trans isomerase PASTICCINO1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g54010`	PPIases accelerate the folding of proteins.	Very-long-chain fatty acids are involved in polar auxin transport and developmental patterning in Arabidopsis.2010 · DOI: 10.1105/tpc.109.071209 The PASTICCINO genes of Arabidopsis thaliana are involved in the control of cell division and differentiation.1998 · DOI: 10.1242/dev.125.5.909 Mutation in the Arabidopsis PASTICCINO1 gene, which encodes a new FK506-binding protein-like protein, has a dramatic effect on plant development.1998 · DOI: 10.1128/mcb.18.5.3034

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016137 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009880 embryonic pattern specification Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0030010 establishment of cell polarity Biological Process

GO:0030154 cell differentiation Biological Process

GO:0042761 very long-chain fatty acid biosynthetic process Biological Process

GO:0048364 root development Biological Process

KEGG gene cross-reference

ath:AT3G54010

bta:516595

dme:Dmel_CG1307

hsa:51651

mmu:217057

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.529

Rank 1 · TkA03G418720 · TK1151

Nucleus0.376

Rank 2 · TkA03G418720 · TK1151

Mitochondrion0.103

Rank 3 · TkA03G418720 · TK1151

Endoplasmic reticulum0.072

Rank 4 · TkA03G418720 · TK1151

Cell membrane0.072

Rank 5 · TkA03G418720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03537Glyco_hydro_11412-51 aa

PF13424TPR_1215-46 aa

PF00515TPR_116-45 aa

PF07719TPR_216-46 aa

PF13181TPR_816-46 aa

PF13374TPR_1016-40 aa

PF13428TPR_1417-48 aa

PF09976TPR_2118-60 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G418720	`PF03537`	Glyco_hydro_114	12	51	0.087	12.5
TkA03G418720	`PF13424`	TPR_12	15	46	0.0031	18.4
TkA03G418720	`PF00515`	TPR_1	16	45	1.2e-06	28.7
TkA03G418720	`PF07719`	TPR_2	16	46	1.8e-06	28.3
TkA03G418720	`PF13181`	TPR_8	16	46	3.8e-05	24.2
TkA03G418720	`PF13374`	TPR_10	16	40	0.03	15.0
TkA03G418720	`PF13428`	TPR_14	17	48	0.18	13.3
TkA03G418720	`PF09976`	TPR_21	18	60	0.12	12.8
TkA03G418720	`PF13371`	TPR_9	20	46	0.017	15.8
TkA03G418720	`PF13174`	TPR_6	20	40	0.51	11.8
TkA03G418720	`PF24524`	DUF7596	39	97	0.17	12.6
TkA03G418720	`PF00515`	TPR_1	55	64	1.2e-06	28.7
TkA03G418720	`PF13181`	TPR_8	55	64	3.8e-05	24.2
TkA03G418720	`PF13174`	TPR_6	62	62	0.51	11.8
TkA03G418720	`PF09976`	TPR_21	64	85	0.12	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7DMA9`	Arabidopsis thaliana	sp\|Q7DMA9\|PAS1_ARATH Peptidyl-prolyl cis-trans isomerase PASTICCINO1	52.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card