TkA03G415260 | RubberDandelionOmics

Gene overview

TkA03G415260

Reference: TK1151 Chr: Chr03 Coordinates: 103281580-103284892 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1446 bp · TkA03G415260|TK1151|cDNA

ATGGACTTAATCACCCCCTCTACTCATGATCATTTAGCGAGTATTAATACCTATTAATTTTTGTGCAATTTATAGGTAGTGCGGGGGACGTATTGGAAGATGATCCAGTCGGAAGGTTAAAAGTGTTTGTTTATGAGCTTCCAAGTAAATACAACAAGAAAATATTACAAAAAGACCCTCGATGTCTGAACCACATGTTTGCAGCAGAAATTTACATGCACAGATTCCTGTTATCAAGCCCTGTTAGAACCCTAAATCCA...

CDS

Download CDS FASTA

1254 bp · TkA03G415260|TK1151|CDS

ATGATGACTAATCGGAGTTGGGGTGTTATTTTACTGGTTTTGTATGCTTTCGTGTTGAATCTTAATGCTTTTGAGCTCCGTAAAGGTCAAAAAACCGAGAGAATTTCAGGTAGTGCGGGGGACGTATTGGAAGATGATCCAGTCGGAAGGTTAAAAGTGTTTGTTTATGAGCTTCCAAGTAAATACAACAAGAAAATATTACAAAAAGACCCTCGATGTCTGAACCACATGTTTGCAGCAGAAATTTACATGCACAGATT...

Protein

Download Protein FASTA

417 aa · TkA03G415260|TK1151|PROTEIN

MMTNRSWGVILLVLYAFVLNLNAFELRKGQKTERISGSAGDVLEDDPVGRLKVFVYELPSKYNKKILQKDPRCLNHMFAAEIYMHRFLLSSPVRTLNPEEADWFYTPVYTTCDLTPNGLPLPFKSPRMMRSAIQLISSNWPYWNRTEGADHFFIVPHDFGACFHYQEEKAIERGILPLLQRATLVQTFGQKNHVCLKEGSITVPPYAPPQKMQSHLIPPSIPRSIFVYFRGLFYDVGNDPEGGYYARGARAAVWENFKDN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G415260`
TK1151 ID	TkA03G415260
OH-1004 ID	LXL04_009278
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G415260

Location Chr03:103281580-103284892 (-)

Description Similar to IRX10L: Probable beta-1,4-xylosyltransferase IRX10L

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61840`	Involved in the synthesis of the hemicellulose glucuronoxylan, a major component of secondary cell walls.	No verified direct reference in this release
`At1g27440`	Involved in the synthesis of the hemicellulose glucuronoxylan, a major component of secondary cell walls.	The Arabidopsis IRX10 and IRX10-LIKE glycosyltransferases are critical for glucuronoxylan biosynthesis during secondary cell wall formation.2009 · DOI: 10.1111/j.1365-313x.2008.03724.x Characterization of IRX10 and IRX10-like reveals an essential role in glucuronoxylan biosynthesis in Arabidopsis.2009 · DOI: 10.1111/j.1365-313x.2008.03729.x Analysis of the Arabidopsis IRX9/IRX9-L and IRX14/IRX14-L pairs of glycosyltransferase genes reveals critical contributions to biosynthesis of the hemicellulose glucuronoxylan.2010 · DOI: 10.1104/pp.110.154971

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0926700`	Involved in the synthesis of glucuronoxylan hemicellulose in secondary cell walls.	No verified direct reference in this release
`Os01g0926600`	Involved in the synthesis of glucuronoxylan hemicellulose in secondary cell walls.	No verified direct reference in this release
`Os02g0520750`	Involved in the synthesis of glucuronoxylan hemicellulose in secondary cell walls.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009278 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009101 glycoprotein biosynthetic process Biological Process

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0010417 glucuronoxylan biosynthetic process Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0045492 xylan biosynthetic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005797 Golgi medial cisterna Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G27440

ath:AT5G61840

dosa:Os01g0926600

dosa:Os01g0926700

dosa:Os02g0520750

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.835

Rank 1 · TkA03G415260 · TK1151

Endoplasmic reticulum0.093

Rank 2 · TkA03G415260 · TK1151

Cytoplasm0.051

Rank 3 · TkA03G415260 · TK1151

Cell membrane0.045

Rank 4 · TkA03G415260 · TK1151

Extracellular0.040

Rank 5 · TkA03G415260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03016Exostosin_GT4750-345 aa

PF24785RXYLT1_C268-308 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G415260	`PF03016`	Exostosin_GT47	50	345	5.6e-75	253.1
TkA03G415260	`PF24785`	RXYLT1_C	268	308	0.024	14.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q940Q8`	Arabidopsis thaliana	sp\|Q940Q8\|IX10L_ARATH Probable beta-1,4-xylosyltransferase IRX10L	91.200%	Swiss-Prot	High
`Q9FZJ1`	Arabidopsis thaliana	sp\|Q9FZJ1\|IRX10_ARATH Probable beta-1,4-xylosyltransferase IRX10	85.900%	Swiss-Prot	High
`Q8S1X7`	Oryza sativa subsp. japonica	sp\|Q8S1X7\|GT15_ORYSJ Probable glucuronosyltransferase Os01g0926700	84.100%	Swiss-Prot	High
`Q8S1X8`	Oryza sativa subsp. japonica	sp\|Q8S1X8\|GT14_ORYSJ Probable glucuronosyltransferase Os01g0926600	84.200%	Swiss-Prot	High
`Q6H4N0`	Oryza sativa subsp. japonica	sp\|Q6H4N0\|GT21_ORYSJ Probable glucuronosyltransferase Os02g0520750	88.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card