TkA03G413700 | RubberDandelionOmics

Gene overview

TkA03G413700

Reference: TK1151 Chr: Chr03 Coordinates: 102886436-102888868 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2073 bp · TkA03G413700|TK1151|cDNA

ATTAAATCATGGGTATTAAATCATGGGATCGCATCAATCTATTTATGAAAAAATGGTAATTTCTTGCAAAAACAGCTATATAGCCCTGTGAATTATAAATTCGTTTTTAGTTTTATTATTTTATAAGTCGCATCGAATAAAAGAAAACCCATTTCTGGTTTACATAAATGATAAAAACCCGTTTTTCTTTAATCCGGATAGGATTTATGACCAATTCGACGTGCACGTCAGCCACGAGTCCACGACTGCACATCCTGGAG...

CDS

Download CDS FASTA

1389 bp · TkA03G413700|TK1151|CDS

ATGAAGAAATCCAAGCGTCCAAAGACACCAAAATGCGAAGATAAAGTTGATTATATCAGCAAATTACCGGATCATATTCTTCTCTTGATTCTTTCGCGTCTTCCATTTACCGAAGATGTAATCCGAACCACCACTTTGTCCACTCGATGGACGCATTTGTGGACTTCAATTCCTTCTCTGGACATAGACCATTCCCGAGGACACAATCCCCCCAAAACATTCAAAAACAACAAATTCAAGAAGTTTGTGCATTCAGTTTT...

Protein

Download Protein FASTA

462 aa · TkA03G413700|TK1151|PROTEIN

MKKSKRPKTPKCEDKVDYISKLPDHILLLILSRLPFTEDVIRTTTLSTRWTHLWTSIPSLDIDHSRGHNPPKTFKNNKFKKFVHSVLANKSIDLESFRLCCSNHYNMSTMRQWINAAITRNVKLLELKFCPKNECKDIALPNSLITCDSLEILRLHLFTRRLSMPGLIGFPSLRVLQLTNAELYHNDPLQDFLINCPLLEDLSLINCLLEELVFLVINCPKLKNLRIENRNKADYLKFEPVGLCGAILLFCPELVSLEFA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G413700`
TK1151 ID	TkA03G413700
OH-1004 ID	LXL04_009259
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G413700

Location Chr03:102886436-102888868 (-)

Description Similar to At5g22730: FBD-associated F-box protein At5g22730

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22730`	FBD-associated F-box protein At5g22730.	No verified direct reference in this release
`At1g66290`	Putative F-box/FBD/LRR-repeat protein At1g66290.	No verified direct reference in this release
`At5g02920`	F-box/LRR-repeat protein 25.	No verified direct reference in this release
`At5g44490`	FBD-associated F-box protein At5g44490.	No verified direct reference in this release
`At1g80960`	F-box protein At1g80960.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009259 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G66290

ath:AT1G69630

ath:AT1G78750

ath:AT1G78760

ath:AT5G22730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.808

Rank 1 · TkA03G413700 · TK1151

Cytoplasm0.236

Rank 2 · TkA03G413700 · TK1151

Cell membrane0.044

Rank 3 · TkA03G413700 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA03G413700 · TK1151

Plastid0.020

Rank 5 · TkA03G413700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box19-58 aa

PF12937F-box-like19-52 aa

PF23622LRR_At1g61320_AtMIF184-420 aa

PF00646F-box92-103 aa

PF19789DUF6273102-120 aa

PF24758LRR_At5g56370111-228 aa

PF12799LRR_4124-155 aa

PF12799LRR_4149-180 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G413700	`PF00646`	F-box	19	58	1.9e-05	25.1
TkA03G413700	`PF12937`	F-box-like	19	52	0.0014	19.1
TkA03G413700	`PF23622`	LRR_At1g61320_AtMIF1	84	420	4.7e-19	69.7
TkA03G413700	`PF00646`	F-box	92	103	1.9e-05	25.1
TkA03G413700	`PF19789`	DUF6273	102	120	0.22	12.0
TkA03G413700	`PF24758`	LRR_At5g56370	111	228	7.7e-14	52.6
TkA03G413700	`PF12799`	LRR_4	124	155	0.0031	18.4
TkA03G413700	`PF12799`	LRR_4	149	180	0.0031	18.4
TkA03G413700	`PF12799`	LRR_4	199	232	0.0031	18.4
TkA03G413700	`PF08387`	FBD	203	217	0.0009	19.8
TkA03G413700	`PF24758`	LRR_At5g56370	247	281	7.7e-14	52.6
TkA03G413700	`PF12937`	F-box-like	267	275	0.0014	19.1
TkA03G413700	`PF08387`	FBD	271	280	0.0009	19.8
TkA03G413700	`PF12799`	LRR_4	310	336	0.0031	18.4
TkA03G413700	`PF24758`	LRR_At5g56370	323	360	7.7e-14	52.6
TkA03G413700	`PF12799`	LRR_4	347	361	0.0031	18.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNI8`	Arabidopsis thaliana	sp\|Q9FNI8\|FBD32_ARATH FBD-associated F-box protein At5g22730	27.000%	Swiss-Prot	Low
`Q9C8Y8`	Arabidopsis thaliana	sp\|Q9C8Y8\|FDL7_ARATH Putative F-box/FBD/LRR-repeat protein At1g66290	25.500%	Swiss-Prot	Low
`Q1PE04`	Arabidopsis thaliana	sp\|Q1PE04\|FBL25_ARATH F-box/LRR-repeat protein 25	35.600%	Swiss-Prot	Low
`Q9FI16`	Arabidopsis thaliana	sp\|Q9FI16\|FBD18_ARATH FBD-associated F-box protein At5g44490	23.500%	Swiss-Prot	Low
`Q9SAG4`	Arabidopsis thaliana	sp\|Q9SAG4\|FB93_ARATH F-box protein At1g80960	30.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card