TkA03G413640 | RubberDandelionOmics

Gene overview

TkA03G413640

Reference: TK1151 Chr: Chr03 Coordinates: 102863688-102866919 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1358 bp · TkA03G413640|TK1151|cDNA

CTATGCAAGCTCACAGATGGGACGCTATGGAAGGAAAGAGAGTACAAGTGTACTACCATCTTACAAGTTGGCGCATTTAGTACTTTGGGGCAGTCCATCATCATTCATACCAACCCTCAACCTCTTGATTTTCGTCATGCCCACGTTCTCCCTCAATTCAACATCTCAAATTTCTGATTTCCCTTTTGTTTAAGGCTTCAAATTTCACCATACGAAGTGTTCGTTCAACCAGGCAATCTGCAAATGGCCGTGTCTATGGC...

CDS

Download CDS FASTA

867 bp · TkA03G413640|TK1151|CDS

ATGGCCGTGTCTATGGCTTCTCATGGCTGTCCTGCTGGGATTTACAACGATTTGGTTGCATCAACAAAGCAATCCATTTCTAAATCCCCAATTTCTACCTTTTCTTTTGGTTCGAATCCGGCTAGACACTTCCGTATTTCACTCAAATCCAGATTGTCATATTCACTGAGAACTATGATTCCAAAAGCTTCAGCCACAGCTTTAGAGGATGAAATTTATCAGGAAACTGATGATGTTCCGATTCCAAAAGTGATCATAGA...

Protein

Download Protein FASTA

288 aa · TkA03G413640|TK1151|PROTEIN

MAVSMASHGCPAGIYNDLVASTKQSISKSPISTFSFGSNPARHFRISLKSRLSYSLRTMIPKASATALEDEIYQETDDVPIPKVIIDQDSDLNSTVVQITFGNRLGALLDTMNALQNLGLNVVKANVHLDSSGKHTKFSITKASTGRKVEDPELLEAIRLTIISNLLKYHPESSSQLAMGEAFGIERPKHKLDVDMATRIHVYDDGPNQSLLSVETADRPGLLVDLVKIFTDVNVAVESGEFDTEGLLAKAKFHVNYRGK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G413640`
TK1151 ID	TkA03G413640
OH-1004 ID	LXL04_009256
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G413640

Location Chr03:102863688-102866919 (-)

Description Similar to ACR11: ACT domain-containing protein ACR11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16880`	May be involved in feedback regulation of amino acid metabolism.	The ACR11 encodes a novel type of chloroplastic ACT domain repeat protein that is coordinately expressed with GLN2 in Arabidopsis.2011 · DOI: 10.1186/1471-2229-11-118
`At5g04740`	May be involved in feedback regulation of amino acid metabolism.	The ACR11 encodes a novel type of chloroplastic ACT domain repeat protein that is coordinately expressed with GLN2 in Arabidopsis.2011 · DOI: 10.1186/1471-2229-11-118

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: P83643`	ACT domain-containing protein DS12, chloroplastic.	No verified direct reference in this release
`Os08g0242700`	ACT domain-containing protein DS12, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009256 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006521 regulation of amino acid metabolic process Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009744 response to sucrose Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT1G16880

ath:AT1G69040

ath:AT5G04740

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.961

Rank 1 · TkA03G413640 · TK1151

Nucleus0.037

Rank 2 · TkA03G413640 · TK1151

Mitochondrion0.032

Rank 3 · TkA03G413640 · TK1151

Cytoplasm0.023

Rank 4 · TkA03G413640 · TK1151

Cell membrane0.019

Rank 5 · TkA03G413640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24931ACT_ACR9_3rd84-165 aa

PF26956ACT_ACR_D192-164 aa

PF24914ACR10_N92-135 aa

PF22754bHLH-TF_ACT-like_plant95-143 aa

PF13291ACT_496-141 aa

PF01842ACT102-132 aa

PF11333DUF3135150-187 aa

PF24931ACT_ACR9_3rd207-245 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G413640	`PF24931`	ACT_ACR9_3rd	84	165	1.2e-08	35.6
TkA03G413640	`PF26956`	ACT_ACR_D1	92	164	1.2e-10	41.9
TkA03G413640	`PF24914`	ACR10_N	92	135	0.0089	16.2
TkA03G413640	`PF22754`	bHLH-TF_ACT-like_plant	95	143	1.3e-06	29.1
TkA03G413640	`PF13291`	ACT_4	96	141	5.5e-07	30.8
TkA03G413640	`PF01842`	ACT	102	132	4.6e-05	23.8
TkA03G413640	`PF11333`	DUF3135	150	187	0.33	12.0
TkA03G413640	`PF24931`	ACT_ACR9_3rd	207	245	1.2e-08	35.6
TkA03G413640	`PF26956`	ACT_ACR_D1	209	255	1.2e-10	41.9
TkA03G413640	`PF24914`	ACR10_N	209	263	0.0089	16.2
TkA03G413640	`PF22754`	bHLH-TF_ACT-like_plant	210	237	1.3e-06	29.1
TkA03G413640	`PF01842`	ACT	211	237	4.6e-05	23.8
TkA03G413640	`PF13291`	ACT_4	212	255	5.5e-07	30.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FZ47`	Arabidopsis thaliana	sp\|Q9FZ47\|ACR11_ARATH ACT domain-containing protein ACR11	70.000%	Swiss-Prot	High
`Q9LZ23`	Arabidopsis thaliana	sp\|Q9LZ23\|ACR12_ARATH ACT domain-containing protein ACR12	59.700%	Swiss-Prot	High
`P83643`	Oryza sativa subsp. indica	sp\|P83643\|UP12_ORYSI ACT domain-containing protein DS12, chloroplastic	70.400%	Swiss-Prot	High
`Q0J709`	Oryza sativa subsp. japonica	sp\|Q0J709\|UP12_ORYSJ ACT domain-containing protein DS12, chloroplastic	70.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card